Akain1 (NM_001145192) Mouse Untagged Clone
CAT#: MC214480
A330050F15Rik (untagged) - Mouse RIKEN cDNA A330050F15 gene (A330050F15Rik), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | A330050F15Rik |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC214480 representing NM_001145192
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTGTTCGCTCCAGGTGAGAAGTCTGGGAAGGAGCTAGAGGAGGTGAAGCTGCAGAACACCAGCAAGC AGATTGTCCAGAATGCCATCCTGCAAGCCATGCGGCAAGTCTCCCAGGAGAGCCTGCGGAGGGAAGGCAG ACCCGGTGACAGCAGGGCCTGGGGCCAGCTGGGAGGGTGCGAGCTGACCAAGAAACATGAAAAGAAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001145192 |
| Insert Size | 210 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001145192.1, NP_001138664.1 |
| RefSeq Size | 2296 bp |
| RefSeq ORF | 210 bp |
| Locus ID | 320722 |
| UniProt ID | G3UWD5 |
| Gene Summary | Protein kinase A (PKA)-binding protein. Binds to type II regulatory subunits of protein kinase A (PKA) and may block the A-kinase anchoring protein (AKAP)-mediated subcellular localization of PKA.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG212820 | A330050F15Rik (tGFP-tagged) - Mouse RIKEN cDNA A330050F15 gene (A330050F15Rik), (10ug) |
CNY 2850.00 |
|
| MR212820 | A330050F15Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA A330050F15 gene (A330050F15Rik) |
CNY 1200.00 |
|
| MR212820L3 | Lenti ORF clone of A330050F15Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA A330050F15 gene (A330050F15Rik) |
CNY 4750.00 |
|
| MR212820L4 | Lenti ORF clone of A330050F15Rik (mGFP-tagged) - Mouse RIKEN cDNA A330050F15 gene (A330050F15Rik) |
CNY 4750.00 |
