Mrgprx2 (NM_001034868) Mouse Untagged Clone
CAT#: MC213182
Mrgprx2 (untagged) - Mouse MAS-related GPR, member X2 (Mrgprx2), (10ug)
CNY 5488.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | G370024M05Rik; MrgB10; Mrgprb10 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001034868, the custom clone sequence may differ by one or more nucleotides
ATGGAGGAAAGAAACATCAGTGGAAGGGATCTAAGAGTGGATTCAAACATAACATACTGGGGAACAAACA TCACAGCTGTGAATGAAAGCAACCATACTGGAATGTCATTTTGTGAAGTCGTGTCTTGTACCATGGTTTT TCTTTCCCTCATTGTTGCCCTAGTTGGGCTGGTTGGAAATGCCACAGTGCTGTGGTTCCTGGGCTTCCAG ATGCGCAGGAATGCATTCTCTGTTTACATCCTCAACCTCGCTGGTGCTGACTTTCTCTTCATTTGCTTTC AAATTGGATATTGTTTTCACATGATCTTGGACATTGATTCCATCCCCATTGAAATTGATCTGTTTTACCT TGTTGTGTTAAACTTTCCTTATTTTTGTGGCCTGAGTATCCTCAGTGCTATTAGCATTGAACGTTGCCTG TCTGTCATGTGGCCCATTTGGTATCACTGCCAACGCCCAAGGCACACATCAGCTGTCATATGTACCCTGC TTTGGGTCTTGTCCCTAGTGTGTAGCCTCCTGGAAGGGAAGGAATGTGGCTTCCTATATTACACTAGTGA CCCTGGTTGGTGTAAGACATTTGATTTAATCACTGCTACATGGTTAATTGTTTTATTTGTAGCTCTCTTG GGATCCAGTCTGGCCTTAGTGATTACCATCTTCTGGGGCTTACACAAGATTCCTGTGACCAGGCTGTATG TGGCCATTGTGTTCACAGTGCTTGTTTTCCTGCTCTTTGGTCTGCCCTATGGGATCTACTGGTTCCTCTT AGTGTGGATTGAGAAATTTTATTATGTTTTACCTTGTAGTATATATCCGGTCACAGTATTTCTCTCCTGT GTTAACAGCTCTGCAAAACCCATCATTTATTGCCTTGTAGGCTCCATTAGGCATCATCGATTTCAACGGA AGACTCTCAAGCTATTTCTGCAGAGAGCCATGCAAGACACTCCTGAGGAGGAAGAATGTGGAGAGATGGG TTCCTCAGGAAGATCTAGAGAAATAAAAACAATCTGGAAAGGACTGAGAGCTGCTTTGATCAGGCATAAA GAGCTCTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001034868 |
| Insert Size | 1059 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC141225, AAI41226 |
| RefSeq Size | 3513 bp |
| RefSeq ORF | 1059 bp |
| Locus ID | 243978 |
| UniProt ID | Q3UG50 |
| Gene Summary | Orphan receptor. Probably involved in the function of nociceptive neurons. May regulate nociceptor function and/or development, including the sensation or modulation of pain (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG216537 | Mrgprx2 (tGFP-tagged) - Mouse MAS-related GPR member X2 (Mrgprx2), (10ug) |
CNY 7088.00 |
|
| MR216537 | Mrgprx2 (Myc-DDK-tagged) - Mouse MAS-related GPR, member X2 (Mrgprx2) |
CNY 5488.00 |
|
| MR216537L3 | Lenti ORF clone of Mrgprx2 (Myc-DDK-tagged) - Mouse MAS-related GPR, member X2 (Mrgprx2) |
CNY 7888.00 |
|
| MR216537L4 | Lenti ORF clone of Mrgprx2 (mGFP-tagged) - Mouse MAS-related GPR, member X2 (Mrgprx2) |
CNY 5890.00 |
其它Mrgprx2产品
