Atp5g3 (NM_175015) Mouse Untagged Clone
CAT＃: MC212816
Atp5g3 (untagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9) (Atp5g3), nuclear gene encoding mitochondrial protein, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 6030447M23; Atp5mc3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC212816 representing NM_175015
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTCGCCTGCGCCAAGCTCGCCCGCACCCCCGCTCTGATCCGAGCTGGATCCAGAGTTGCATATAGAC CAATTTCTGCATCAGTGTTATCTCGGCCAGAGACTAGGACTGGAGAGGGCTCTACAGTTTTTAATGGGGC CCAGAATGGTGTGTGTCAGCTGATCCGAAGGGAGTTTCAGACCAGTGTAATCAGCAGAGACATTGATACT GCTGCCAAATTCATTGGTGCAGGTGCTGCAACAGTAGGAGTTGCTGGTTCTGGTGCTGGTATTGGAACAG TCTTTGGCAGTCTTATCATTGGTTATGCCAGAAACCCTTCACTGAAGCAGCAGCTGTTCTCATATGCTAT CCTGGGATTTGCCTTGTCTGAAGCTATGGGTCTCTTTTGTTTGATGGTTGCGTTCTTGATCTTGTTTGCC ATGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_175015 |
| Insert Size | 426 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_175015.3, NP_778180.1 |
| RefSeq Size | 729 bp |
| RefSeq ORF | 426 bp |
| Locus ID | 228033 |
| UniProt ID | P56384 |
| Gene Summary | The protein encoded by this gene is a subunit of mitochondrial membrane ATP synthase, the enzyme that catalyzes ATP synthesis during oxidative phosphorylation. This gene encodes subunit 9, which is present in multiple copies in the transmembrane part of the ATP synthase complex. Phenotype and gene expression profiles suggest correlations between this gene and alcoholism- and obesity-related phenotypes. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same isoform (a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG220908 | Atp5g3 (tGFP-tagged) - Mouse ATP synthase H+ transporting mitochondrial F0 complex subunit C3 (subunit 9) (Atp5g3) nuclear gene encoding mitochondrial protein, (10ug) |
CNY 2850.00 |
|
| MR220908 | Atp5g3 (Myc-DDK-tagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9) (Atp5g3), nuclear gene encoding mitochondrial protein |
CNY 1200.00 |
|
| MR220908L3 | Lenti ORF clone of Atp5g3 (Myc-DDK-tagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9) (Atp5g3), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
|
| MR220908L4 | Lenti ORF clone of Atp5g3 (mGFP-tagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9) (Atp5g3), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
