Adm2 (NM_182928) Mouse Untagged Clone
CAT#: MC212713
Adm2 (untagged) - Mouse adrenomedullin 2 (Adm2), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Am2; IM; IMD; Imdn; inter |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC212713 representing NM_182928
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCCAGTTGCTGATGGTCACGGTAACCCTCGGTTGCATCAGCCTCCTCTACCTGCTCCCCGGCACGT TGTCTGGCAGCCTGGGCAAGGGACTGAGGCACTCCAGACCCAGAGAGCCCCCAGCTAAGATTCCTTCCAG TAACCTGCAGCCTGGACACCCTTCCCTTCAGCCTGTAGTCTGGAAGTCTCGTCGTCATGCCCCCCAGCCA CAGGGAAGGGGCAACAGGGCCCTTGCTATGGTTCATCTGCCTCAGGGTGGTGGCTCACGACACCCTGGTC CCCAGCGTCCCACGGGATCCCGAAGACCCCATGCCCAGCTCCTGCGGGTTGGCTGTGTACTGGGTACATG CCAAGTCCAGAATCTTAGCCATCGCCTGTGGCAGCTTGTCCGGCCAGCTGGCCGGCGGGACTCAGCTCCT GTGGATCCCAGCAGCCCCCACAGTTATGGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_182928 |
| Insert Size | 453 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_182928.5, NP_891558.1 |
| RefSeq Size | 1300 bp |
| RefSeq ORF | 453 bp |
| Locus ID | 223780 |
| UniProt ID | Q7TNK8 |
| Gene Summary | This gene encodes a member of the calcitonin gene-related peptide (CGRP)/calcitonin family of hormones that play a role in the regulation of cardiovascular homeostasis, prolactin release, anti-diuresis, anti-natriuresis, and regulation of food and water intake. The encoded protein is proteolytically processed to generate one or more biologically active peptides. Intravenous injection of the active peptide was found to protect mouse lungs from ischemia/reperfusion injury. [provided by RefSeq, Aug 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201053 | Adm2 (tGFP-tagged) - Mouse adrenomedullin 2 (Adm2) |
CNY 2800.00 |
|
| MR201053 | Adm2 (Myc-DDK-tagged) - Mouse adrenomedullin 2 (Adm2) |
CNY 1200.00 |
|
| MR201053L3 | Lenti ORF clone of Adm2 (Myc-DDK-tagged) - Mouse adrenomedullin 2 (Adm2) |
CNY 4750.00 |
|
| MR201053L4 | Lenti ORF clone of Adm2 (mGFP-tagged) - Mouse adrenomedullin 2 (Adm2) |
CNY 4750.00 |
