Hmbox1 (NM_177338) Mouse Untagged Clone

CAT#: MC212703

Hmbox1 (untagged) - Mouse homeobox containing 1 (Hmbox1), (10ug)



  "NM_177338" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Hmbox1 Antibody - C-terminal region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI451877; AI604847; F830020C16Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212703 representing NM_177338
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTCAGCTCCTTTCCAGTGGTTTTGCTGGAAACCATGTCTCACTACACAGATGAACCCAGATTTACCA
TAGAACAGATAGACCTGCTCCAGCGTCTTCGGCGTACCGGGATGACCAAACATGAAATCCTTCATGCATT
AGAAACTTTGGACCGTCTTGATCAAGAGCATAGTGATAAATTTGGAAGGAGGTCCAGCTACGGGGGAAGC
TCATATGGGAACAGTACCAACAACGTTCCAGCATCTTCCTCTACAGCCACAGCTTCCACGCAGACCCAGC
ACTCGGGAATGTCCCCATCACCCAGCAACAGTTACGATACCTCCCCACTGCCTTGCACTACCAATCAAAA
TGGGAGGGAGAACAATGATCGATTGTCCACATCCAATGGGAAGATGTCACCATCTCGCTACCATGCAAAC
AGCATGGGTCAGAGGTCATATAGCTTTGAGGCCTCAGAAGAGGACCTAGATGTAGATGATAAAGTGGAGG
AATTAATGAGGAGGGACAGCAGTGTGATAAAAGAGGAAATCAAAGCCTTTCTTGCCAATCGGAGGATTTC
CCAAGCAGTTGTTGCACAGGTAACAGGAATCAGTCAGAGTCGAATCTCTCACTGGCTGCTGCAGCAGGGA
TCAGATCTGAGTGAGCAGAAGAAAAGGGCGTTCTACCGATGGTATCAACTTGAGAAGACAAACCCTGGGG
CTACGCTAAGTATGAGACCTGCCCCCATTCCAATAGAGGACCCTGAATGGAGACAAACACCTCCCCCAGT
CTCCGCCACACCTGGAACCTTCCGGCTTCGACGAGGGAGTAGATTTACCTGGAGAAAGGAGTGCCTAGCT
GTCATGGAAAGTTACTTCAATGAGAACCAGTACCCAGATGAAGCAAAGAGAGAAGAAATTGCCAATGCTT
GCAATGCAGTCATACAGAAGCCAGGCAAAAAGCTGTCTGACCTGGAACGAGTTACCTCTCTGAAAGTATA
TAATTGGTTTGCTAATCGACGGAAGGAGATCAAGAGAAGAGCCAATATCGCAGCAATCCTGGAGAGTCAT
GGGATAGATGTACAGAGTCCAGGAGGCCATTCCAACAGTGACGATGTGGACGGGAACGACTACTCCGAGC
AGGATGACAGCACCAGCCATAGTGACCACCAAGATCCCATCTCGCTAGCTGTGGAGATGGCGGCCGTCAA
CCACACTATCTTGGCATTGGCCCGGCAGGGAGCCAATGAAATCAAGACAGAGGCCCTGGATGATGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_177338
Insert Size 1260 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_177338.5, NP_796312.2
RefSeq Size 2931 bp
RefSeq ORF 1260 bp
Locus ID 219150
UniProt ID Q8BJA3
Gene Summary Binds directly to 5'-TTAGGG-3' repeats in telomeric DNA (By similarity). Associates with the telomerase complex at sites of active telomere processing and positively regulates telomere elongation (By similarity). Important for TERT binding to chromatin, indicating a role in recruitment of the telomerase complex to telomeres (PubMed:23685356). Also plays a role in the alternative lengthening of telomeres (ALT) pathway in telomerase-negative cells where it promotes formation and/or maintenance of ALT-associated promyelocytic leukemia bodies (APBs) (By similarity). Enhances formation of telomere C-circles in ALT cells, suggesting a possible role in telomere recombination (By similarity). Might also be involved in the DNA damage response at telomeres (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (2) has the same N- and C-termini, but is one aa shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...