Cisd3 (NM_001085500) Mouse Untagged Clone
CAT#: MC212662
Cisd3 (untagged) - Mouse CDGSH iron sulfur domain 3 (Cisd3), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Mel-13; Mel13 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC212662 representing NM_001085500
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCTTCCGGCGTCTCTCCTTCCCCACTGATTTTATTTTTCTGTTTCCAAATCATATCTGCCTGCCTG CCTTGTCGAAGCCGTATCAGAGGCGGGAAATCTCTTCTTGGCTGGCCCGATGGTTCCCCAAAGACCCAGC CAAGCCAGTGGTGGCACAGAAGACACCCATCAGATTGGAGCTGGTTGCCGGGAAAACCTACAGGTGGTGT GTATGTGGCCGAAGCAAGAATCAGCCCTTCTGTGATGGCTCCCACTTCTTCCAGCGTACTGGCCTTTCTC CACTCAAGTTCAAGGCCCAAGAGACACGCACAGTGGCCCTATGTACCTGCAAGGCCACTCAGCGGCCCCC TTACTGTGACGGTACCCACAAGAGTGAGCAGGTACAGAAAGCAGAAGTAGGTTCCCCACTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001085500 |
| Insert Size | 414 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001085500.2, NP_001078969.2 |
| RefSeq Size | 750 bp |
| RefSeq ORF | 414 bp |
| Locus ID | 217149 |
| UniProt ID | B1AR13 |
| Gene Summary | Can transfer its iron-sulfur clusters to the apoferrodoxins FDX1 and FDX2. Contributes to mitochondrial iron homeostasis and in maintaining normal levels of free iron and reactive oxygen species, and thereby contributes to normal mitochondrial function.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG222427 | Cisd3 (tGFP-tagged) - Mouse CDGSH iron sulfur domain 3 (Cisd3), (10ug) |
CNY 2850.00 |
|
| MR222427 | Cisd3 (Myc-DDK-tagged) - Mouse CDGSH iron sulfur domain 3 (Cisd3) |
CNY 1200.00 |
|
| MR222427L3 | Lenti ORF clone of Cisd3 (Myc-DDK-tagged) - Mouse CDGSH iron sulfur domain 3 (Cisd3) |
CNY 4750.00 |
|
| MR222427L4 | Lenti ORF clone of Cisd3 (mGFP-tagged) - Mouse CDGSH iron sulfur domain 3 (Cisd3) |
CNY 4750.00 |
