Nudt15 (NM_172527) Mouse Untagged Clone
CAT#: MC212604
Nudt15 (untagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 15 (Nudt15), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 6530403O17; A730068G11Rik; MTH2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC212604 representing NM_172527
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGCTAACGCAGAGCCGAGGCGGCGGCCAGGAGTTGGGGTCGGCGTGGTGGTGCTGAGCTGCGAGC ATCCTCGCTGCGTCCTTCTGGGGAAAAGGAAAGGATCGTTTGGAGCCGGCAGTTTCCAGCTTCCTGGGGG CCATTTGGAATTCGGTGAGACCTGGGAAGAATGCGCTCAGAGAGAAACCTGGGAAGAAGCTGGGCTTCAC CTGAAAAATGTGTGCTTTGCCTCCGTGGTAAATTCTTTTGTTGAGAAGGAGAATTACCATTATGTTACCA TATTAATGAAAGGAGAGGTGGATATGACTCATGATTCGGAGCCGAGGAATATGGAGCCTGAAAAGAATGA AAGTTGGGAGTGGGTTCCATGGGAAGAATTCCCTCCCTTAGACCAGCTTTTCTGGGCTCTCCGCTGTCTA AAAGAGCAAGGTTATGACCCATTTAAAGAGGACCTGAACCACCTGGAAGGGTACCGAGGAGAGCACCTTG AAAGGACCACGAAGACTCCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_172527 |
| Insert Size | 513 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_172527.2, NP_766115.1 |
| RefSeq Size | 2592 bp |
| RefSeq ORF | 513 bp |
| Locus ID | 214254 |
| UniProt ID | Q8BG93 |
| Gene Summary | May catalyze the hydrolysis of nucleoside triphosphates including dGTP, dTTP, dCTP, their oxidized forms like 8-oxo-dGTP and the prodrug thiopurine derivatives 6-thio-dGTP and 6-thio-GTP (PubMed:12767940). Could also catalyze the hydrolysis of some nucleoside diphosphate derivatives (By similarity). Hydrolyzes oxidized nucleosides triphosphates like 8-oxo-dGTP in vitro, but the specificity and efficiency towards these substrates are low. Therefore, the potential in vivo sanitizing role of this enzyme, that would consist in removing oxidatively damaged forms of nucleosides to prevent their incorporation into DNA, is unclear (PubMed:12767940). Through the hydrolysis of thioguanosine triphosphates may participate in the catabolism of thiopurine drugs (By similarity). May also have a role in DNA synthesis and cell cycle progression by stabilizing PCNA (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in its 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201427 | Nudt15 (tGFP-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 15 (Nudt15) |
CNY 2850.00 |
|
| MR201427 | Nudt15 (Myc-DDK-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 15 (Nudt15) |
CNY 2400.00 |
|
| MR201427L3 | Lenti ORF clone of Nudt15 (Myc-DDK-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 15 (Nudt15) |
CNY 4750.00 |
|
| MR201427L4 | Lenti ORF clone of Nudt15 (mGFP-tagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 15 (Nudt15) |
CNY 4750.00 |
