Eif5a2 (NM_177586) Mouse Untagged Clone

CAT#: MC212509

Eif5a2 (untagged) - Mouse eukaryotic translation initiation factor 5A2 (Eif5a2), (10ug)



  "NM_177586" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 9630038B20; eIF5AII
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212509 representing NM_177586
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGACGAAATTGATTTCACTACTGGAGATGCAGGGGCTTCCAGCACTTATCCTATGCAGTGCTCAG
CCCTGCGCAAAAACGGCTTCGTCGTGCTCAAAGGGCGACCATGCAAAATCGTGGAGATGTCAACTTCCAA
GACTGGGAAGCATGGTCATGCCAAGGTACACCTTGTTGGAATTGACATTTTCACTGGCAAAAAATATGAA
GACATTTGTCCTTCTACTCACAACATGGATGTTCCAAATATTAAGAGAAACGATTATCAACTCATATGCA
TTCAGGATGGTTACCTTTCCCTGCTGACAGAAACTGGCGAAGTCCGTGAAGATCTTAAGCTGCCAGAAGG
TGAACTGGGCAAAGAAATAGAAGGGAAATACAATGCAGGTGAAGATGTGCAGGTGTCTGTCATGTGTGCC
ATGAGTGAAGAATACGCTGTAGCCATAAAGCCCTGCAAATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_177586
Insert Size 462 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_177586.5, NP_808254.1
RefSeq Size 4992 bp
RefSeq ORF 462 bp
Locus ID 208691
UniProt ID Q8BGY2
Gene Summary mRNA-binding protein involved in translation elongation. Has an important function at the level of mRNA turnover, probably acting downstream of decapping. Involved in actin dynamics and cell cycle progression, mRNA decay and probably in a pathway involved in stress response and maintenance of cell wall integrity. Functions as a regulator of apoptosis. Mediates effects of polyamines on neuronal process extension and survival. May play an important role in brain development and function, and in skeletal muscle stem cell differentiation (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...