Eif5a2 (NM_177586) Mouse Untagged Clone
CAT#: MC212509
Eif5a2 (untagged) - Mouse eukaryotic translation initiation factor 5A2 (Eif5a2), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 9630038B20; eIF5AII |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC212509 representing NM_177586
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGACGAAATTGATTTCACTACTGGAGATGCAGGGGCTTCCAGCACTTATCCTATGCAGTGCTCAG CCCTGCGCAAAAACGGCTTCGTCGTGCTCAAAGGGCGACCATGCAAAATCGTGGAGATGTCAACTTCCAA GACTGGGAAGCATGGTCATGCCAAGGTACACCTTGTTGGAATTGACATTTTCACTGGCAAAAAATATGAA GACATTTGTCCTTCTACTCACAACATGGATGTTCCAAATATTAAGAGAAACGATTATCAACTCATATGCA TTCAGGATGGTTACCTTTCCCTGCTGACAGAAACTGGCGAAGTCCGTGAAGATCTTAAGCTGCCAGAAGG TGAACTGGGCAAAGAAATAGAAGGGAAATACAATGCAGGTGAAGATGTGCAGGTGTCTGTCATGTGTGCC ATGAGTGAAGAATACGCTGTAGCCATAAAGCCCTGCAAATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_177586 |
| Insert Size | 462 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_177586.5, NP_808254.1 |
| RefSeq Size | 4992 bp |
| RefSeq ORF | 462 bp |
| Locus ID | 208691 |
| UniProt ID | Q8BGY2 |
| Gene Summary | mRNA-binding protein involved in translation elongation. Has an important function at the level of mRNA turnover, probably acting downstream of decapping. Involved in actin dynamics and cell cycle progression, mRNA decay and probably in a pathway involved in stress response and maintenance of cell wall integrity. Functions as a regulator of apoptosis. Mediates effects of polyamines on neuronal process extension and survival. May play an important role in brain development and function, and in skeletal muscle stem cell differentiation (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG224747 | Eif5a2 (tGFP-tagged) - Mouse eukaryotic translation initiation factor 5A2 (Eif5a2), (10ug) |
CNY 2850.00 |
|
| MR224747 | Eif5a2 (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 5A2 (Eif5a2) |
CNY 1200.00 |
|
| MR224747L3 | Lenti ORF clone of Eif5a2 (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 5A2 (Eif5a2) |
CNY 4750.00 |
|
| MR224747L4 | Lenti ORF clone of Eif5a2 (mGFP-tagged) - Mouse eukaryotic translation initiation factor 5A2 (Eif5a2) |
CNY 4750.00 |
