Sun3 (NM_177576) Mouse Untagged Clone

CAT#: MC212468

Sun3 (untagged) - Mouse Sad1 and UNC84 domain containing 3 (Sun3), (10ug)



  "NM_177576" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Sunc1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212468 representing NM_177576
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCTAAGGAGCAACAGGAACTTTTAAAGAAAGAAAGCCAGACTTTGGAGAACAATTTTCGTGAAATTC
TGTTTTTAATTGAACAAATAGATGTTCTGAAGGCGTTGCTTAAAGACATGAAGGACGGCGTACACAATCA
CAGCTTGCCTGTTCACCGAGATGCTGTGCAGGACCAGGCCACTACTGACGTTCTAGATGAGGAAATGTCA
AACTTGGTACATTATGTGCTTAAAAAGTTCAGAGGGGACCAAATACAGTTGGCTGATTATGCCTTGAAGT
CAGCAGGAGCCTCTGTCATTGAAGCTGGGACCTCAGAAAGTTACAAAAATAATAAAGCAAAACTGTACTG
GCATGGCATAGGGTTCCTCAACTATGAGATGCCTCCGGATATGATACTTCAGCCAGATGTCCACCCTGGG
AAGTGCTGGGCCTTTCCAGGTTCCCAGGGTCACATCCTGATTAAGCTCGCCAGGAAGATCATCCCAACAG
CAGTTACCATGGAGCACATCTCGGAGAAGGTGTCCCCTTCAGGAAACATCTCAAGTGCACCCAAGGAGTT
CTCTGTCTATGGCGTTATGAAGAAATGTGAAGGAGAAGAAATATTCCTAGGTCAGTTTATTTATAACAAA
ATGGAAGCAACCATTCAAACATTTGAGCTCCAGAATGAAGCTTCTGAATCTTTGCTATGTGTAAAACTTC
AAATCCTTAGCAACTGGGGACATCCAAAGTATACGTGTTTGTACCGATTTAGAGTCCACGGCATCCCCAG
TGATTACACTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_177576
Insert Size 783 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_177576.3, NP_808244.1
RefSeq Size 1205 bp
RefSeq ORF 783 bp
Locus ID 194974
UniProt ID Q5SS91
Gene Summary As a probable component of the LINC (LInker of Nucleoskeleton and Cytoskeleton) complex, involved in the connection between the nuclear lamina and the cytoskeleton. The nucleocytoplasmic interactions established by the LINC complex play an important role in the transmission of mechanical forces across the nuclear envelope and in nuclear movement and positioning. May be involved in nuclear remodeling during sperm head formation in spermatogenenis. A probable SUN3:SYNE1 LINC complex may tether spermatid nuclei to posterior cytoskeletal structures such as the manchette.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) contains an alternate 5'-terminal exon, lacks part of the 5' coding region, and uses a downstream start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...