Mcrip1 (NM_001033231) Mouse Untagged Clone
CAT#: MC212436
Fam195b (untagged) - Mouse family with sequence similarity 195, member B (Fam195b), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Fam195b; Mcrip1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC212436 representing NM_001033231
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACCAGCTCTCCTGTCTCCAGAGTTGTCTACAACGGCAAGAGGAATAGCAGTCCCCGCTCTCCCACCA ACAGCAGTGAGATTTTCACACCGGCACACGAAGAGAATGTGCGCTTCATTTATGAAGCCTGGCAGGGTGT TGAGCGAGACCTGCGCAGCCAGCTGTCCAGTGGTGAGCGGTGCCTAGTGGAGGAGTATGTGGAGAAAGTC CCCAACCCCAGCCTGAAGACCTTCAAGCCCATCGACCTGAGTGACCTGAAGCGCCGGAACACGCAGGATG CCAAGAAGTCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001033231 |
Insert Size | 294 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001033231.2, NP_001028403.1 |
RefSeq Size | 1286 bp |
RefSeq ORF | 294 bp |
Locus ID | 192173 |
UniProt ID | Q3UGS4 |
Gene Summary | The phosphorylation status of MCRIP1 functions as a molecular switch to regulate epithelial-mesenchymal transition. Unphosphorylated MCRIP1 binds to and inhibits the transcriptional corepressor CTBP(s). When phosphorylated by MAPK/ERK, MCRIP1 releases CTBP(s) resulting in transcriptional silencing of the E-cadherin gene and induction of epithelial-mesenchymal transition.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG214029 | Fam195b (tGFP-tagged) - Mouse family with sequence similarity 195 member B (Fam195b), (10ug) |
CNY 2850.00 |
|
MR214029 | Fam195b (Myc-DDK-tagged) - Mouse family with sequence similarity 195, member B (Fam195b) |
CNY 1200.00 |
|
MR214029L3 | Lenti ORF clone of Fam195b (Myc-DDK-tagged) - Mouse family with sequence similarity 195, member B (Fam195b) |
CNY 4750.00 |
|
MR214029L4 | Lenti ORF clone of Fam195b (mGFP-tagged) - Mouse family with sequence similarity 195, member B (Fam195b) |
CNY 4750.00 |