Plpbp (NM_001039077) Mouse Untagged Clone
CAT#: MC212287
Prosc (untagged) - Mouse proline synthetase co-transcribed (Prosc), transcript variant 2, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1700024N20Rik; 2200002F22Rik; Prosc |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC212287 representing NM_001039077
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTGAGAGGTGGCAGCATGACGGCGGAGCTGGGAGTCGGGTTCGCGCTGCGGGCCGTGAACGAGCGAG TCCAGCAGAGTGTGGCGCGGCGGCCGCGGGACCTCCCAGCCATCCAACCCCGGCTCGTTGCGGTCAGCAA AACAAAACCTGCAGACATGGTGATCGAGGCCTATGGCCACGGCCAGCGCACTTTTGGAGAGAACTATGTT CAGGAACTACTAGAAAAAGCATCAAACCCTAAGATTCTGTCTTCCTGTCCCGAGATCAAGTGGCACTTCA TTGGTCATTTACAGAAACAAAACGTCAACAAACTGATGGCCGTCCCCAACCTCTCTATGCTGGAAACCGT AGACTCGGTGAAGCTGGCAGACAAGGTGAATAGCTCCTGGCAGAAGAAAGGTCCTACAGAACCACTGAAG GTGATGGTCCAGATTAACACCAGCGGAGAGGACAGTAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001039077 |
| Insert Size | 462 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001039077.2, NP_001034166.1 |
| RefSeq Size | 1463 bp |
| RefSeq ORF | 462 bp |
| Locus ID | 114863 |
| Gene Summary | Pyridoxal 5'-phosphate (PLP)-binding protein, which may be involved in intracellular homeostatic regulation of pyridoxal 5'-phosphate (PLP), the active form of vitamin B6.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses a different splice site in the 3' coding region and lacks several segments in the coding region, compared to variant 4. The resulting protein (isoform b) has a shorter and distinct C-terminus when it is compared to isoform d. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR201110 | Prosc (Myc-DDK-tagged) - Mouse proline synthetase co-transcribed (Prosc), transcript variant 2 |
CNY 1200.00 |
|
| MR201110L3 | Lenti ORF clone of Prosc (Myc-DDK-tagged) - Mouse proline synthetase co-transcribed (Prosc), transcript variant 2 |
CNY 4750.00 |
|
| MR201110L4 | Lenti ORF clone of Prosc (mGFP-tagged) - Mouse proline synthetase co-transcribed (Prosc), transcript variant 2 |
CNY 4750.00 |
