Selenom (NM_053267) Mouse Untagged Clone
CAT#: MC212282
Selm (untagged) - Mouse selenoprotein M (Selm), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Synonyms | 1500040L08Rik; A230103K18; Se; Selm; Sepm |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC212282 representing NM_053267
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCATCCTACTGTCGCCGCCGTCGCTGCTGCTGCTTCTTGCAGCCCTTGTGGCTCCAGCCACCTCCA CCACCAACTACCGACCGGATTGGAACCGTCTTCGAGGCCTGGCCAGGGGGCGGGTGGAGACCTGTGGAGG ATGACAGTTGAATCGCCTAAAGGAGGTGAAGGCCTTTGTCACCGAGGACATTCAACTGTACCACAACCTG GTGATGAAGCACCTCCCTGGGGCAGACCCCGAACTCGTGCTGTTAAGCCGAAATTACCAGGAACTAGAGC GAATCCCACTCAGCCAAATGACCCGGGACGAGATCAATGCGCTGGTACAGGAGCTCGGCTTCTACCGCAA GTCGGCGCCGGAAGCTCAGGTGCCCCCCGAGTACCTGTGGGCGCCCGCTAAGCCCCCCGAGGAAGCTTCA GAACACGACGACCTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_053267 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins. |
| OTI Annotation | This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_053267.2, NP_444497.1 |
| RefSeq Size | 888 bp |
| RefSeq ORF | 438 bp |
| Locus ID | 114679 |
| UniProt ID | Q8VHC3 |
| Gene Summary | The protein encoded by this gene belongs to the selenoprotein M/SEP15 family. The exact function of this protein is not known. It is localized in the perinuclear region, is highly expressed in the brain, and may be involved in neurodegenerative disorders. Transgenic mice with targeted deletion of this gene exhibit increased weight gain, suggesting a role for this gene in the regulation of body weight and energy metabolism. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. [provided by RefSeq, Dec 2016] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG220959 | Selm (GFP-tagged) - Mouse selenoprotein M (Selm), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 2850.00 |
|
| MR220959 | Ept1 (Myc-DDK-tagged) - Mouse ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) (Ept1), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 998.00 |
其它Selenom产品
