Clps (NM_025469) Mouse Untagged Clone
CAT#: MC212216
Clps (untagged) - Mouse colipase, pancreatic (Clps), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2200003J09Rik |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC212216 representing NM_025469
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGAAGGTCCTTGTTCTTCTGCTTGTGTCCCTCCTTGCAGTGGCCTATGCAGCTCCCGGACCCCGGG GTCTTATTATCAACCTGGAGGACGGTGAGATCTGTTTGAACAGTATGCAGTGTAAGAGCAGATGCTGCCA ACATGACACCATCCTGGGCATTGCCCGTTGCACACACAAGGCCATGGAGAACAGCGAGTGCTCCCCAAAG ACCCTCTATGGGATCTACTACCGGTGTCCCTGTGAGCGGGGCCTGACCTGTGAGGGGGACAGGAGCATCA TCGGCGCCATCACCAACACCAACTATGGCATCTGCCTCGACTCCAGGCGCTCCAAGCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_025469 |
| Insert Size | 342 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_025469.3, NP_079745.1 |
| RefSeq Size | 557 bp |
| RefSeq ORF | 342 bp |
| Locus ID | 109791 |
| UniProt ID | Q9CQC2 |
| Gene Summary | This gene encodes a member of the colipase family of coenzymes that is required for the optimal activity of pancreatic lipase. The encoded protein undergoes proteolytic processing to generate a mature polypeptide that binds to the lipase and prevents inhibition by bile acids. Over half of the mice lacking the encoded protein die within two weeks of birth while the remaining ones exhibit fat malabsorption and altered body weight regulation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG226150 | Clps (tGFP-tagged) - Mouse colipase pancreatic (Clps), (10ug) |
CNY 2850.00 |
|
| MR226150 | Clps (Myc-DDK-tagged) - Mouse colipase, pancreatic (Clps) |
CNY 1200.00 |
|
| MR226150L3 | Lenti ORF clone of Clps (Myc-DDK-tagged) - Mouse colipase, pancreatic (Clps) |
CNY 4750.00 |
|
| MR226150L4 | Lenti ORF clone of Clps (mGFP-tagged) - Mouse colipase, pancreatic (Clps) |
CNY 4750.00 |
