U2af1 (NM_024187) Mouse Untagged Clone

CAT#: MC212172

U2af1 (untagged) - Mouse U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1 (U2af1), transcript variant 1, (10ug)



  "NM_024187" in other vectors (4)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
U2AF1 Antibody - C-terminal region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 35kDa; 2010107D16Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212172 representing NM_024187
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGAATACTTGGCCTCCATCTTCGGCACCGAAAAAGACAAAGTCAACTGTTCATTTTATTTCAAAA
TCGGAGCATGTCGTCATGGAGACAGATGTTCTCGGTTGCACAATAAACCAACCTTTAGCCAGACCATTGC
CCTCTTGAACATTTACCGTAACCCTCAAAACTCTTCCCAGTCTGCTGACGGTTTGCGCTGTGCTGTGAGC
GACGTGGAGATGCAGGAGCACTATGATGAGTTCTTTGAGGAAGTCTTCACTGAGATGGAAGAGAAGTACG
GGGAAGTCGAGGAGATGAACGTCTGCGACAACCTAGGGGACCACCTGGTGGGGAACGTGTATGTCAAGTT
TCGACGTGAGGAGGATGCAGAGAAAGCCGTGATCGACTTGAATAACCGTTGGTTTAATGGACAGCCGATC
CATGCAGAGCTGTCCCCAGTAACTGACTTCAGGGAAGCCTGCTGCCGCCAGTATGAAATGGGAGAGTGCA
CAAGAGGGGGCTTCTGCAACTTCATGCATTTGAAGCCCATCTCAAGAGAGCTACGACGGGAGCTGTATGG
GCGCCGGCGCAAGAAGCATAGATCCAGGTCCCGATCCAGGGAACGGCGTTCCCGATCCAGAGACCGTGGA
CGCGGTGGTGGAGGTGGAGGTGGAGGTGGCGGAGGACGGGAGCGTGACAGGAGGCGGTCAAGAGACCGGG
AGAGATCTGGACGATTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_024187
Insert Size 720 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC115479, AAI15480
RefSeq Size 849 bp
RefSeq ORF 720 bp
Locus ID 108121
UniProt ID Q9D883
Gene Summary Plays a critical role in both constitutive and enhancer-dependent splicing by mediating protein-protein interactions and protein-RNA interactions required for accurate 3'-splice site selection. Recruits U2 snRNP to the branch point. Directly mediates interactions between U2AF2 and proteins bound to the enhancers and thus may function as a bridge between U2AF2 and the enhancer complex to recruit it to the adjacent intron (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes isoform 1. Variants 1 and 2 are the same length, as are isoforms 1 and 2; however, their sequences vary slightly.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...