U2af1 (NM_024187) Mouse Untagged Clone
CAT#: MC212172
U2af1 (untagged) - Mouse U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1 (U2af1), transcript variant 1, (10ug)
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 35kDa; 2010107D16Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC212172 representing NM_024187
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGAATACTTGGCCTCCATCTTCGGCACCGAAAAAGACAAAGTCAACTGTTCATTTTATTTCAAAA TCGGAGCATGTCGTCATGGAGACAGATGTTCTCGGTTGCACAATAAACCAACCTTTAGCCAGACCATTGC CCTCTTGAACATTTACCGTAACCCTCAAAACTCTTCCCAGTCTGCTGACGGTTTGCGCTGTGCTGTGAGC GACGTGGAGATGCAGGAGCACTATGATGAGTTCTTTGAGGAAGTCTTCACTGAGATGGAAGAGAAGTACG GGGAAGTCGAGGAGATGAACGTCTGCGACAACCTAGGGGACCACCTGGTGGGGAACGTGTATGTCAAGTT TCGACGTGAGGAGGATGCAGAGAAAGCCGTGATCGACTTGAATAACCGTTGGTTTAATGGACAGCCGATC CATGCAGAGCTGTCCCCAGTAACTGACTTCAGGGAAGCCTGCTGCCGCCAGTATGAAATGGGAGAGTGCA CAAGAGGGGGCTTCTGCAACTTCATGCATTTGAAGCCCATCTCAAGAGAGCTACGACGGGAGCTGTATGG GCGCCGGCGCAAGAAGCATAGATCCAGGTCCCGATCCAGGGAACGGCGTTCCCGATCCAGAGACCGTGGA CGCGGTGGTGGAGGTGGAGGTGGAGGTGGCGGAGGACGGGAGCGTGACAGGAGGCGGTCAAGAGACCGGG AGAGATCTGGACGATTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_024187 |
Insert Size | 720 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC115479, AAI15480 |
RefSeq Size | 849 bp |
RefSeq ORF | 720 bp |
Locus ID | 108121 |
UniProt ID | Q9D883 |
Gene Summary | Plays a critical role in both constitutive and enhancer-dependent splicing by mediating protein-protein interactions and protein-RNA interactions required for accurate 3'-splice site selection. Recruits U2 snRNP to the branch point. Directly mediates interactions between U2AF2 and proteins bound to the enhancers and thus may function as a bridge between U2AF2 and the enhancer complex to recruit it to the adjacent intron (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes isoform 1. Variants 1 and 2 are the same length, as are isoforms 1 and 2; however, their sequences vary slightly. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG218412 | U2af1 (tGFP-tagged) - Mouse U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1 (U2af1) transcript variant 1, (10ug) |
CNY 2850.00 |
|
MR218412 | U2af1 (Myc-DDK-tagged) - Mouse U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1 (U2af1), transcript variant 1 |
CNY 3810.00 |
|
MR218412L3 | Lenti ORF clone of U2af1 (Myc-DDK-tagged) - Mouse U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1 (U2af1), transcript variant 1 |
CNY 4750.00 |
|
MR218412L4 | Lenti ORF clone of U2af1 (mGFP-tagged) - Mouse U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1 (U2af1), transcript variant 1 |
CNY 4750.00 |