Adprhl2 (NM_133883) Mouse Untagged Clone

CAT#: MC212053

Adprhl2 (untagged) - Mouse ADP-ribosylhydrolase like 2 (Adprhl2), nuclear gene encoding mitochondrial protein, (10ug)



  "NM_133883" in other vectors (4)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI836109; Arh3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212053 representing NM_133883
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGTGGCTGCGGCGGCAGCAGCTACAGCGATGTCGGCGGCGGGGGGCGGCGGGGCAAGTGCGGCCC
GCTCCATCTCGCGCTTCCGAGGTTGCCTGGCGGGCGCGCTGCTGGGAGATTGCGTGGGCGCTGTCTACGA
GGCACACGATACCGTCAGCCTGGCATCAGTCCTGAGTCACGTCGAGAGCCTGGAGCCGGACCCGGGCACG
CCGGGCAGCGCGCGGACAGAGACACTGTACTACACAGATGACACTGCCATGACCAGGGCCCTGGTGCAGT
CCCTGCTGGCCAAGGAGGCCTTCGACGAGGTGGACATGGCTCACAGGTTTGCCCAGGAATACAAGAAGGA
CCCTGACAGAGGGTATGGGGCCGGAGTCATCACTGTCTTCAAGAAACTCCTGAATCCCAAGTGCCGTGAT
GTCTATGAGCCTGCCCGGGCCCAGTTCAACGGGAAGGGTTCCTATGGCAATGGGGGTGCCATGCGGGTAG
CAGGCATCTCGCTGGCCTATAGCAGTGTCCAAGATGTACAGAAGTTTGCCCGGCTCTCGGCCCAGCTGAC
CCACGCCTCTTCCCTGGGCTATAACGGTGCCATCTTGCAGGCCCTGGCTGTGCACCTTGCTCTGCAGGGT
GTATCATCCAGTGAGCACTTCCTTGAGCAGCTTCTGGGCCACATGGAGGAGCTGGAAGGTGATGCCCAAT
CGGTCTTGGACGCCAAGGAGTTGGGTATGGAGGAGCGTCCGTACTCCAGCAGGCTGAAGAAGGTCGGAGA
GCTGCTGGACCAGGACGTGGTGAGCCGAGAGGAAGTGGTGTCCGAGCTAGGGAATGGCATTGCCGCCTTT
GAATCTGTGCCCACCGCCATCTACTGCTTCCTGCGCTGCATGGAGCCTCACCCTGAGATCCCCTCCACCT
TCAACAGTCTCCAGAGGACTCTCATCTACTCCATCTCACTTGGTGGGGACACAGACACCATAGCCACCAT
GGCTGGGGCCATTGCTGGAGCTTACTATGGGATGGAACAGGTGCCGGAGAGCTGGCAGCAAAGTTGTGAA
GGCTTTGAGGAGACAGACGTCCTGGCCCAGAGCCTGCACCGAGTCTTCCAGGAGAGCTCGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_133883
Insert Size 1113 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_133883.2, NP_598644.1
RefSeq Size 1368 bp
RefSeq ORF 1113 bp
Locus ID 100206
UniProt ID Q8CG72
Gene Summary ADP-ribose glycohydrolase that preferentially hydrolyzes the scissile alpha-O-linkage attached to the anomeric C1'' position of ADP-ribose and acts on different substrates, such as proteins ADP-ribosylated on serine, free poly(ADP-ribose) and O-acetyl-ADP-D-ribose (By similarity). Specifically acts as a serine mono-ADP-ribosylhydrolase by mediating the removal of mono-ADP-ribose attached to serine residues on proteins, thereby playing a key role in DNA damage response (By similarity). Serine ADP-ribosylation of proteins constitutes the primary form of ADP-ribosylation of proteins in response to DNA damage (By similarity). Does not hydrolyze ADP-ribosyl-arginine, -cysteine, -diphthamide, or -asparagine bonds (By similarity). Also able to degrade protein free poly(ADP-ribose), which is synthesized in response to DNA damage: free poly(ADP-ribose) acts as a potent cell death signal and its degradation by ADPRHL2 protects cells from poly(ADP-ribose)-dependent cell death, a process named parthanatos (PubMed:24191052). Also hydrolyzes free poly(ADP-ribose) in mitochondria (By similarity). Specifically digests O-acetyl-ADP-D-ribose, a product of deacetylation reactions catalyzed by sirtuins (By similarity). Specifically degrades 1''-O-acetyl-ADP-D-ribose isomer, rather than 2''-O-acetyl-ADP-D-ribose or 3''-O-acetyl-ADP-D-ribose isomers (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...