Hamp (NM_032541) Mouse Untagged Clone
CAT#: MC211974
Hamp (untagged) - Mouse hepcidin antimicrobial peptide (Hamp), (10ug)
CNY 1200.00
CNY 3990.00
Cited in 1 publication. |
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Hamp1; Hep; Hepc; Hepc1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_032541, the custom clone sequence may differ by one or more nucleotides
ATGGCACTCAGCACTCGGACCCAGGCTGCCTGTCTCCTGCTTCTCCTCCTTGCCAGCCTGAGCAGCACCA CCTATCTCCATCAACAGATGAGACAGACTACAGAGCTGCAGCCTTTGCACGGGGAAGAAAGCAGGGCAGA CATTGCGATACCAATGCAGAAGAGAAGGAAGAGAGACACCAACTTCCCCATCTGCATCTTCTGCTGTAAA TGCTGTAACAATTCCCAGTGTGGTATCTGTTGCAAAACATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_032541 |
Insert Size | 252 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC021587, AAH21587 |
RefSeq Size | 393 bp |
RefSeq ORF | 252 bp |
Locus ID | 84506 |
UniProt ID | Q9EQ21 |
Gene Summary | This gene encodes hepcidin, an antimicrobial peptide and master hormonal regulator of systemic iron metabolism. The encoded preproprotein is synthesized in the hepatocytes where it undergoes proteolytic processing to generate disulfide-linked mature peptides that are secreted into the bloodstream. Mice lacking the encoded protein develop multivisceral iron overlaod, with sparing of the spleen macrophages. Certain mutations in the human ortholog of this gene cause hemochromatosis type 2B, also known as juvenile hemochromatosis. This gene is located adjacent to a related hepcidin gene on chromosome 7. [provided by RefSeq, Aug 2016] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Role of hepcidin in oxidative stress and cell death of cultured mouse renal collecting duct cells: protection against iron and sensitization to cadmium
,null,
Archives of Toxicology
,PubMed ID 34181029
[Hamp]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227187 | Hamp (tGFP-tagged) - Mouse hepcidin antimicrobial peptide (Hamp), (10ug) |
CNY 2800.00 |
|
MR227187 | Hamp (Myc-DDK-tagged) - Mouse hepcidin antimicrobial peptide (Hamp) |
CNY 1200.00 |
|
MR227187L3 | Lenti ORF clone of Hamp (Myc-DDK-tagged) - Mouse hepcidin antimicrobial peptide (Hamp) |
CNY 4750.00 |
|
MR227187L4 | Lenti ORF clone of Hamp (mGFP-tagged) - Mouse hepcidin antimicrobial peptide (Hamp) |
CNY 4750.00 |