Kcnip2 (NM_145704) Mouse Untagged Clone
CAT#: MC211935
Kcnip2 (untagged) - Mouse Kv channel-interacting protein 2 (Kcnip2), transcript variant c, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | KChI; KChIP2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211935 representing NM_145704
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCGGGGCCAAGGCCGAAAGGAGAGTTTGTCCGAATCCCGAGATTTGGACGGCTCCTATGACCAGCTTA CGGACAGCGTGGAGGATGAGTTTGAACTATCCACGGTGTGCCACCGGCCTGAGGGTCTGGAACAACTCCA GGAACAAACCAAGTTCACACGCAGAGAGTTGCAGGTCCTGTACAGAGGCTTCAAGAACGAATGTCCCAGC GGAATTGTCAACGAGGAGAACTTCAAGCAAATTTATTCTCAGTTCTTTCCCCAAGGAGACTCCAGCAACT ACGCTACTTTTCTCTTCAATGCCTTTGACACCAACCATGATGGCTCTGTCAGTTTTGAGGACTTTGTGGC TGGTTTGTCAGTGATTCTTCGGGGAACCATAGATGATAGACTGAACTGGGCTTTCAACTTATATGACCTC AACAAGGATGGCTGTATCACGAAGGAGGAAATGCTCGACATCATGAAGTCCATCTATGACATGATGGGCA AGTACACCTACCCTGCCCTCCGGGAGGAGGCCCCGAGGGAACACGTGGAGAGCTTCTTCCAGAAGATGGA CAGAAACAAGGACGGCGTGGTGACCATTGAGGAATTCATTGAGTCTTGTCAACAGGACGAGAACATCATG AGGTCCATGCAACTCTTTGATAATGTCATCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_145704 |
Insert Size | 663 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_145704.2, NP_663750.1 |
RefSeq Size | 2264 bp |
RefSeq ORF | 663 bp |
Locus ID | 80906 |
UniProt ID | Q9JJ69 |
Gene Summary | This gene encodes a member of the voltage-gated potassium channel-interacting protein (KCNIP) family. KCNIP family members are small calcium binding proteins that commonly exhibit unique variation at their N-termini, and which modulate A-type potassium channels. This gene is predominantly expressed in the adult heart, and to a lesser extent in the brain. Disruption of this gene is associated with susceptibility to cardiac arrhythmias and lack of transient outward potassium current in ventricular myocytes, and downregulated expression is associated with cardiac hypertrophy. The encoded protein has also been implicated as a repressor of immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013] Transcript Variant: This variant (c) lacks two consecutive internal exons in the coding region but maintains the reading frame, compared to variant a. The encoded isoform (c, also known as KCHIP2S) is shorter, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223584 | Kcnip2 (tGFP-tagged) - Mouse Kv channel-interacting protein 2 (Kcnip2) transcript variant c, (10ug) |
CNY 2380.00 |
|
MR223584 | Kcnip2 (Myc-DDK-tagged) - Mouse Kv channel-interacting protein 2 (Kcnip2), transcript variant c |
CNY 2190.00 |
|
MR223584L3 | Lenti ORF clone of Kcnip2 (Myc-DDK-tagged) - Mouse Kv channel-interacting protein 2 (Kcnip2), transcript variant c |
CNY 4090.00 |
|
MR223584L4 | Lenti ORF clone of Kcnip2 (mGFP-tagged) - Mouse Kv channel-interacting protein 2 (Kcnip2), transcript variant c |
CNY 4090.00 |