H2az2 (NM_029938) Mouse Untagged Clone
CAT#: MC211827
H2afv (untagged) - Mouse H2A histone family, member V (H2afv), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | C530002L11Rik; H2a; H2A.Z; H2a.z-2; H2A.Z2; H2afv; H2av; Tg(Wnt1-cre)11Rth; Wnt1-Cre; Wnt1::Cre; Wnt1cre |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211827 representing NM_029938
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTGGAGGCAAAGCTGGAAAAGACAGTGGGAAGGCCAAGGCTAAGGCGGTGTCTCGTTCCCAGCGAG CTGGGCTCCAGTTTCCTGTGGGCCGCATCCACAGACACTTGAAGACTCGCACCACAAGCCATGGACGGGT GGGCGCCACTGCTGCTGTGTACAGTGCCGCAATTCTGGAGTACCTCACAGCTGAGGTGTTGGAGTTAGCA GGTAATGCTTCCAAAGATCTCAAAGTGAAGCGCATCACCCCACGTCACTTACAGCTTGCAATCCGCGGTG ATGAAGAGTTGGATTCTCTTATCAAGGCCACCATAGCCGGGGGCGGCGTGATCCCGCACATCCACAAGTC TCTGATTGGAAAGAAGGGGCAGCAGAAAACTGCTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_029938 |
Insert Size | 387 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_029938.1, NP_084214.1 |
RefSeq Size | 1636 bp |
RefSeq ORF | 387 bp |
Locus ID | 77605 |
UniProt ID | Q3THW5 |
Gene Summary | Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG217606 | H2afv (tGFP-tagged) - Mouse H2A histone family member V (H2afv), (10ug) |
CNY 2850.00 |
|
MR217606 | H2afv (Myc-DDK-tagged) - Mouse H2A histone family, member V (H2afv) |
CNY 1200.00 |
|
MR217606L3 | Lenti ORF clone of H2afv (Myc-DDK-tagged) - Mouse H2A histone family, member V (H2afv) |
CNY 4750.00 |
|
MR217606L4 | Lenti ORF clone of H2afv (mGFP-tagged) - Mouse H2A histone family, member V (H2afv) |
CNY 4750.00 |