Unkl (NM_028789) Mouse Untagged Clone

CAT#: MC211491

Unkl (untagged) - Mouse unkempt-like (Drosophila) (Unkl), transcript variant 2, (10ug)



  "NM_028789" in other vectors (4)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-Unkl Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1300004G08Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211491 representing NM_028789
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGTCCTCCCACCTTGCCAGGTTCTGCCTTAGATCTTCGTCTTAGTGACATAAACATCGCGTCCTTAG
ATAAAGACTTAGAAGAACAGGACCTTGGATTGACAGGTCTGAACGGCGTTCCCGGGAGCATCTGGGACTT
TGTTTCTGGCAGCTTCTCTCCTAGCCCATCCCCCATTCTGAACTCCGGCCCTTCGGCTTCCTCAAGTGCA
AGTCCAAACAGTGCTGAGCTGGCACGGGTCAGGCGGCAGCTAGACGAGGCCAAGAGGAAGATCAGGCAAT
GGGAAGAATCTTGGCAGCAAGTGAAGCAGGCCTGTGATGCCTGGCAGAGAGAGGCTCAGGAGGCCAAGGA
AAGAGCCCGTGTGGCAGACAGTGACCGGCAGCTGGCCCTGCAGAGGAAAGAAGAGGTGGAAGCCAAGGTG
AAGCAGCTGCAGGAAGAATTAGAGGGCCTGGGTTTGTCCTCACTGCCAGGGCTTCAGAGCTTGGGTGACA
TCAGTGACATCCCTCTCCCCAAGCTGCATTCTCTCCAGAGCAAGCTGCGCTTGGACTTGGAGGCTGTGGA
TGGGGTGATCTTCCAGCTCCGTGCCAAACAGTGTGTGGCCTGCCAGGAGCGGGCCCATGGCACTGTCCTG
CGGCCCTGCCAGCACCGTGTCTTATGCGAACCATGTGCGGCCAGTACCCCTGAGTGCCCCTACTGCAAGG
GCCAGCCCCTACCATGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_028789
Insert Size 720 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC150842, AAI50843
RefSeq Size 790 bp
RefSeq ORF 720 bp
Locus ID 74154
UniProt ID Q5FWH2
Gene Summary May participate in a protein complex showing an E3 ligase activity regulated by Rac1. Ubiquitination is directed towards itself and possibly other substrates, such as Baf60b/Smarcd2. Intrinsic E3 ligase activity has not been proven.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...