Mrgbp (NM_028479) Mouse Untagged Clone
CAT＃: MC211396
Mrgbp (untagged) - Mouse RIKEN cDNA 1600027N09 gene (1600027N09Rik), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1600027N09Rik; AW060503; C80444 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC211396 representing NM_028479
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGGAGGCCGAGGTGGGCGGCACGGGCGCCCCAGGCGACAAGGGCCCAGGCGAGGCAGCCCCGAGCC CTGCTGAGGAGACGGTGGTGTGGAGCCCTGAGGTGGAAGTGTGCCTCTTCCACGCCATGCTGGGCCACAA GCCTGTCGGGGTGAATCGGCACTTCCACATGATTTGTATCCGAGACAAGTTCAGCCAGAATATTGGGCGC CAGGTTCCATCCAAGGTGATCTGGGACCATCTGAGCACTATGTACGACATGCAGGCACTGCACGAGTCTG AGATTCTTCCATTCCCAAATCCAGAGAGGAACTTTGTCCTTCCAGATGAGATCATTCAGGAAGTCCGAGA AGGAAAAGTGGTCATTGAAGAAGAAATGAAGGAGGAGATGAAGGAGGATGTGGACCCCCACAGTGGGGCT GATGATGTTTTTTCATCTTCAGGGAGCTTGGGGAAAGCATTAGAAAAATCCAGCAAAGACAAAGAGAAGA ACTCCTCAGACTTGGGGTGCAAAGAAGGGGCAGACAAGCGGAAGCGCAGCCGGGTCACTGACAAGGTCCT GACTGCCAACAGCAATCCCTCCAGCCCCAGTGCTGCCAAGAGGCGCCGCACATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_028479 |
| Insert Size | 615 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_028479.1, NP_082755.1 |
| RefSeq Size | 1192 bp |
| RefSeq ORF | 615 bp |
| Locus ID | 73247 |
| UniProt ID | Q9DAT2 |
| Gene Summary | Component of the NuA4 histone acetyltransferase (HAT) complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. NuA4 may also play a direct role in DNA repair when recruited to sites of DNA damage.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202130 | Mrgbp (tGFP-tagged) - Mouse RIKEN cDNA 1600027N09 gene (1600027N09Rik) |
CNY 2850.00 |
|
| MR202130 | Mrgbp (Myc-DDK-tagged) - Mouse RIKEN cDNA 1600027N09 gene (1600027N09Rik) |
CNY 2400.00 |
|
| MR202130L3 | Lenti ORF clone of Mrgbp (Myc-DDK-tagged) - Mouse RIKEN cDNA 1600027N09 gene (1600027N09Rik) |
CNY 4750.00 |
|
| MR202130L4 | Lenti ORF clone of Mrgbp (mGFP-tagged) - Mouse RIKEN cDNA 1600027N09 gene (1600027N09Rik) |
CNY 4750.00 |
