Hspb11 (NM_028394) Mouse Untagged Clone
CAT#: MC211369
Hspb11 (untagged) - Mouse heat shock protein family B (small), member 11 (Hspb11), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2900042B11Rik; IFT25; PP25 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211369 representing NM_028394
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGGAAAGTGGATCTCTGCTCAGTCACTGAAGGGACAGAAGTGATTCTGGCCACATCGAGTGATGAAA AGCACCCACCTGAAAACATCATTGATGGGAATCCGGAAACCTTTTGGACCACCACAGGCATGTTTCCCCA GGAGTTCATTATTTGTTTTCACAAACACGTAAAGATTGAAAAGCTTGTGATACAAAGTTACTTGGTGCGG ACTTTGAGGATTGAAAAGACCACATCTAAAGAGCCATTGGATTTTGAGCAGTGGGTTGAAAAAGATTTAG TACACACAGAGGGGCAGCTTCAAAATGAAGAAATTGTGGCACGAGATGGCTACGCCACTTTCTTGAGATT CATTATTGTCTCAGCATTTGATCATTTTGCATCTGTGCACAGCATTTCTGCAGAGGGACTAACAGTCTCA AGTCTTCCTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_028394 |
Insert Size | 432 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_028394.2, NP_082670.1 |
RefSeq Size | 559 bp |
RefSeq ORF | 432 bp |
Locus ID | 72938 |
UniProt ID | Q9D6H2 |
Gene Summary | Component of the IFT complex B required for sonic hedgehog/SHH signaling. May mediate transport of SHH components: required for the export of SMO and PTCH1 receptors out of the cilium and the accumulation of GLI2 at the ciliary tip in response to activation of the SHH pathway, suggesting it is involved in the dynamic transport of SHH signaling molecules within the cilium. Not required for ciliary assembly (PubMed:22595669). Its role in intraflagellar transport is mainly seen in tissues rich in ciliated cells such as kidney and testis. Essential for male fertility, spermiogenesis and sperm flagella formation (PubMed:28430876). Plays a role in the early development of the kidney (PubMed:29626631). May be involved in the regulation of ureteric bud initiation (PubMed:29626631).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript. Variants 1-3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223698 | Hspb11 (tGFP-tagged) - Mouse heat shock protein family B (small) member 11 (Hspb11), (10ug) |
CNY 2090.00 |
|
MR223698 | Hspb11 (Myc-DDK-tagged) - Mouse heat shock protein family B (small), member 11 (Hspb11) |
CNY 1900.00 |
|
MR223698L3 | Lenti ORF clone of Hspb11 (Myc-DDK-tagged) - Mouse heat shock protein family B (small), member 11 (Hspb11) |
CNY 3800.00 |
|
MR223698L4 | Lenti ORF clone of Hspb11 (mGFP-tagged) - Mouse heat shock protein family B (small), member 11 (Hspb11) |
CNY 3800.00 |