Exosc6 (NM_028274) Mouse Untagged Clone

CAT#: MC211340

Exosc6 (untagged) - Mouse exosome component 6 (Exosc6), (10ug)



  "NM_028274" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2610510N21Rik; C76919; Mtr3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211340 representing NM_028274
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGGGAGACCATCGCCGCATCCGCGGGCCGGAGGAGTCTCAGCCGCCGCAGCTGTACGCGGCCGAAG
ACGACGAGACGCCCGCTGCTCGCGACCCGACGCGGCTCCGCCCGGTGTACGCGCGCGCCGGGCTGCTGAG
CCAGGCCAAGGGCTCCGCCTACCTGGAGGCGGGCGGGACCAAGGTGCTGTGCGCCGTGTCCGGTCCGCGG
CAGGCCGAGGGCGGCGAGCGCGGCAGCGGCCCTGCGGGAGCGGGCGGGGAAGCTCCCGCTGCCCTCCGGG
GTCGCCTGCTCTGCGATTTCCGCCGCGCTCCCTTCTCCGGTCGCCGGCGTCGCGCGCCCCAGGGCGGCGG
CGGGGAGGATCGCGAGCTGGGACTGGCGCTACAGGAGGCTCTGGAGCCCGCCGTGCGCCTGGGGCGCTAC
CCGCGTGCTCAGCTCGAGGTGTCGGCGCTGCTGCTGGAGGACGGCGGCTGTGCGCTGGCCGCGGCGCTCA
CCGCGGCCGCGCTCGCCCTGGCCGACGCGGGAGTGGAGATGTACGATCTGGTGGTGGGCTGCGGCCTGAG
CCTCACCCCGGGACCCTCCCCGACCTGGCTGCTGGACCCCACGCGGCTGGAGGAGGAGCACTCCGCGGCC
GGTCTCACGGTGGCCCTCATGCCTGTGCTCAATCAGGTGGCCGGGTTACTGGGCAGTGGGGAAGGCGGGC
AGACTGAGAGTTGGACCGATGCTGTGCGCCTGGGCCTGGAGGGCTGCCAGCGCCTCTACCCAGTGCTGCA
GCAGTGTTTGGTGCGGGCTGCCCGCCGGAGGGGTGCCGCCGCCCCACCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_028274
Insert Size 822 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_028274.4, NP_082550.1
RefSeq Size 1346 bp
RefSeq ORF 822 bp
Locus ID 72544
UniProt ID Q8BTW3
Gene Summary Non-catalytic component of the RNA exosome complex which has 3'->5' exoribonuclease activity and participates in a multitude of cellular RNA processing and degradation events. In the nucleus, the RNA exosome complex is involved in proper maturation of stable RNA species such as rRNA, snRNA and snoRNA, in the elimination of RNA processing by-products and non-coding 'pervasive' transcripts, such as antisense RNA species and promoter-upstream transcripts (PROMPTs), and of mRNAs with processing defects, thereby limiting or excluding their export to the cytoplasm. The RNA exosome may be involved in Ig class switch recombination (CSR) and/or Ig variable region somatic hypermutation (SHM) by targeting AICDA deamination activity to transcribed dsDNA substrates. In the cytoplasm, the RNA exosome complex is involved in general mRNA turnover and specifically degrades inherently unstable mRNAs containing AU-rich elements (AREs) within their 3' untranslated regions, and in RNA surveillance pathways, preventing translation of aberrant mRNAs. It seems to be involved in degradation of histone mRNA. The catalytic inactive RNA exosome core complex of 9 subunits (Exo-9) is proposed to play a pivotal role in the binding and presentation of RNA for ribonucleolysis, and to serve as a scaffold for the association with catalytic subunits and accessory proteins or complexes (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...