Ifi35 (NM_027320) Mouse Untagged Clone

CAT#: MC211040

Ifi35 (untagged) - Mouse interferon-induced protein 35 (Ifi35), (10ug)



  "NM_027320" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2010008K16Rik; AW986054; ifi-35; IFP35
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211040 representing NM_027320
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGTGACCCTGCAAACTGTCCTCTACAGTCTTCAGGAGGAGCAAGCCAGGCTCAAGATGAGGCTGC
AGGAGCTGCAGCAGCTCAAAAGGGAGCGCACAGGCTCTCCCGGAGCCAAGATCCCATTCTCAGTACCTGA
AGTTCCTCTGGTATTCCAAGGCCAAACTAAGCAGGGCAGGCAAGTGCCCAAGTTTGTAGTTTCTAACTTG
AAGGTCTGCTGCCCTCTGCCTGAAGGTTCTGCTCTGGTCACCTTTGAGGACCCCAAAGTGGTTGATCGGT
TGCTACAACAAAAGGAACACAGAGTTAACTTAGAGGACTGCCGGCTGCGGGTGCAGGTCCAGCCCTTGGA
GCTGCCTGTGGTGACCAACATTCAGGTGTCCAGCCAGCCAGATAACCACAGGGTGCTCGTTAGTGGTTTT
CCTGCTGGACTTAGGCTGAGTGAAGAGGAACTGTTGGACAAGCTGGAGATCTTCTTTGGCAAGGCCAAGA
ATGGAGGTGGGGATGTAGAGACCCGGGAGATGCTGCAAGGGACCGTCATGCTAGGGTTTGCTGATGAAGA
AGTGGCCCAGCACTTATGCCAGATTGGCCAGTTCAGAGTCCCACTGGACCGGCAGCAGGTCCTCCTGAGG
GTCTCTCCCTATGTGAGTGGTGAGATCCAGAAAGCCGAGATCAAATTCCAGCAAGCCCCTCATTCAGTGC
TGGTGACAAATATTCCTGATGTCATGGATGCCCAGGAACTGCATGACATCCTTGAGATCCACTTCCAGAA
GCCCACTCGTGGGGGCGGGGAGGTGGAGGCCCTGACAGTTGTGCCTTCAGGGCAGCAGGGCCTGGCTATC
TTCACTTCCGAGTCAAGCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_027320
Insert Size 861 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_027320.4, NP_081596.1
RefSeq Size 1360 bp
RefSeq ORF 861 bp
Locus ID 70110
UniProt ID Q9D8C4
Gene Summary Acts as a signaling pathway regulator involved in innate immune system response (PubMed:29350881). In response to interferon IFN-alpha, associates in a complex with transcriptional regulator NMI to regulate immune response; the complex formation prevents proteasome-mediated degradation of IFI35 and correlates with IFI35 dephosphorylation (By similarity). In complex with NMI, inhibits virus-triggered type I interferon/IFN-beta production (By similarity). In complex with NMI, negatively regulates nuclear factor NF-kappa-B signaling by inhibiting the nuclear translocation, activation and transcription of the NF-kappa-B subunit p65/RELA, resulting in the inhibition of endothelial cell proliferation, migration and re-endothelialization of injured arteries (PubMed:29350881). Beside its role as an intracellular signaling pathway regulator, also functions extracellularly as damage-associated molecular patterns (DAMPs) to promote inflammation when actively released by macrophage to the extracellular space during cell injury and pathogen invasion (By similarity). Macrophage-secreted IFI35 activates NF-kappa-B signaling in adjacent macrophages through Toll-like receptor 4/TLR4 activation, thereby inducing NF-kappa-B translocation from the cytoplasm into the nucleus which promotes the release of proinflammatory cytokines (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...