Meaf6 (NM_027310) Mouse Untagged Clone
CAT#: MC211037
Meaf6 (untagged) - Mouse MYST/Esa1-associated factor 6 (Meaf6), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2310005N01Rik; 2810036M01Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211037 representing NM_027310
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGATGCACAACAAGACGGCGCCGCCGCAGATCCCAGACACCCGGCGGGAGCTGGCCGAGCTGGTTA AGCGGAAGCAGGAGCTGGCGGAAACACTTGCAAACTTGGAGAGACAGATATATGCTTTTGAAGGAAGCTA CCTGGAAGACACTCAGATGTATGGCAATATTATCCGTGGCTGGGATCGGTATTTGACCAATCAAAAGAAC TCCAATAGCAAAAACGACCGGAGGAACCGGAAGTTCAAGGAGGCCGAACGGCTCTTCAGCAAATCCTCAG TCACGTCGGCTGCTGCAGTAAGTGCCTTGGCAGGGGTTCAGGACCAGCTCATCGAAAAGAGGGAACCAGG AAGTGGGACGGAAAGCGATACTTCTCCAGACTTCCACAATCAGGAAAACGAGCCTGCGCAGGAGGACCCC GAGGACCTAGACGGCTCCGTCCAGGGAGTGAAACCTCAGAAAGCCGCCTCTTCCACCTCCTCAGGAAGCC ACCACAGCAGCCACAAAAAACGGAAGAATAAAAACCGGCACAGAATGAATGTCTCCCCCCAAACTGGCTG GCACCAGCTCCATCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_027310 |
Insert Size | 579 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_027310.4, NP_081586.1 |
RefSeq Size | 1070 bp |
RefSeq ORF | 579 bp |
Locus ID | 70088 |
UniProt ID | Q2VPQ9 |
Gene Summary | Component of the NuA4 histone acetyltransferase complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histone H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. Component of the HBO1 complex which has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. Component of the MOZ/MORF complex which has a histone H3 acetyltransferase activity (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224817 | Meaf6 (tGFP-tagged) - Mouse MYST/Esa1-associated factor 6 (Meaf6), (10ug) |
CNY 2850.00 |
|
MR224817 | Meaf6 (Myc-DDK-tagged) - Mouse MYST/Esa1-associated factor 6 (Meaf6) |
CNY 2400.00 |
|
MR224817L3 | Lenti ORF clone of Meaf6 (Myc-DDK-tagged) - Mouse MYST/Esa1-associated factor 6 (Meaf6) |
CNY 4750.00 |
|
MR224817L4 | Lenti ORF clone of Meaf6 (mGFP-tagged) - Mouse MYST/Esa1-associated factor 6 (Meaf6) |
CNY 4750.00 |