Il1f8 (NM_027163) Mouse Untagged Clone
CAT#: MC210986
Il1f8 (untagged) - Mouse interleukin 1 family, member 8 (Il1f8), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2310043N20Rik; Il36b |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210986 representing NM_027163
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGGCTTTCCCTCCACAATCTTGTGTACATGTTCTTCCTCCAAAGAGTATTCAAATGTGGGAACCGA ATCATAACACTATGCATGGATCCTCACAATCTCCCAGAAACTACAGGGTTCATGACTCACAACAGATGGT ATGGGTCCTGACTGGAAATACTTTAACAGCAGTTCCTGCTAGCAACAATGTCAAGCCTGTCATTCTTAGC TTGATAGCATGTAGAGACACGGAATTCCAAGATGTAAAGAAAGGTAATCTAGTTTTCCTGGGAATCAAGA ACAGAAATCTCTGCTTCTGCTGTGTTGAGATGGAGGGCAAACCAACTTTGCAGCTTAAGGAAGTAGACAT CATGAATTTGTACAAAGAGAGAAAAGCACAAAAAGCCTTTCTGTTCTATCATGGCATAGAGGGCTCCACT TCTGTCTTTCAGTCAGTCCTCTATCCTGGCTGGTTTATAGCCACCTCTTCCATAGAAAGACAGACAATCA TCCTCACACATCAGCGGGGTAAATTGGTTAACACTAACTTCTACATAGAGTCTGAGAAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_027163 |
Insert Size | 552 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_027163.4, NP_081439.1 |
RefSeq Size | 790 bp |
RefSeq ORF | 552 bp |
Locus ID | 69677 |
UniProt ID | Q9D6Z6 |
Gene Summary | Cytokine that binds to and signals through the IL1RL2/IL-36R receptor which in turn activates NF-kappa-B and MAPK signaling pathways in target cells linked to a pro-inflammatory response. Part of the IL-36 signaling system that is thought to be present in epithelial barriers and to take part in local inflammatory response; similar to the IL-1 system with which it shares the coreceptor IL1RAP. Stimulates production of interleukin-6 and interleukin-8 in synovial fibrobasts, articular chondrocytes and mature adipocytes. Induces expression of a number of antimicrobial peptides including beta-defensin 4 and beta-defensin 103 as well as a number of matrix metalloproteases (By similarity). Seems to be involved in skin inflammatory response by acting on keratinocytes, dendritic cells and indirectly on T-cells to drive tissue infiltration, cell maturation and cell proliferation. Induces the production of proinflammatory cytokines in bone marrow-derived dendritic cells (BMDCs), including IL-12, Il-1 beta, IL-6, TNF-alpha and IL-23, and activates p38 MAPK phosphorylation in BMDCs. Involved in dendritic cell maturation by stimulating the surface expression of CD80, CD86 and MHC class II. Induces the production of IFN-gamma, IL-4 and IL-17 by T-helper 1 (Th1) cells, cultured CD4(+) T-cells and splenocytes.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG220215 | Il1f8 (tGFP-tagged) - Mouse interleukin 1 family member 8 (Il1f8), (10ug) |
CNY 2850.00 |
|
MR220215 | Il1f8 (Myc-DDK-tagged) - Mouse interleukin 1 family, member 8 (Il1f8) |
CNY 2400.00 |
|
MR220215L3 | Lenti ORF clone of Il1f8 (Myc-DDK-tagged) - Mouse interleukin 1 family, member 8 (Il1f8) |
CNY 4750.00 |
|
MR220215L4 | Lenti ORF clone of Il1f8 (mGFP-tagged) - Mouse interleukin 1 family, member 8 (Il1f8) |
CNY 4750.00 |