Gins1 (NM_001163476) Mouse Untagged Clone
CAT#: MC210879
Gins1 (untagged) - Mouse GINS complex subunit 1 (Psf1 homolog) (Gins1), transcript variant 2, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2810418N01Rik; Gins4; mKIAA0186; PSF1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC210879 representing NM_001163476
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTCTGCGAAAAAGCTATGGAGCTTGTCCGCGAGTTACACCGCGCGCCGGAAGGGCAGCTGCCGGCCT TTAATGAGGACGGACTCAGACAAGTTCTGGAGGAGATGAAAGCTTTGTATGAACAAAACCAGTCTGATGT GAATGAAGCCAAGTCAGCTGGACGAGGGGATCTGATACCAACCGTCAAATTTCGGCACTGTGCTTTGTTA AGAAATAGACGCTGCACGATAGCATACCTGTATGACCGGTTGCTTCGGATTAGAGCACTCAGGTGGGAAT ATGGGAGTGTCTTGCCAAATAGTTTACGATTCCACATGTCTGCTGAAGAAACGGAGTGGTTCAACCATTA TAAAAAGTCTCTTGCTACTTACATGAGGTCGCTGGGAGGAGATGAAGGCTTGGACATCACACAAGATGTG AAGCCCCCCAAAAGCCTATATATTGAAGTATGTGTACCTACTTTAATGCATATATTGTGCTACCCTCTAT AA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001163476 |
| Insert Size | 492 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001163476.1, NP_001156948.1 |
| RefSeq Size | 677 bp |
| RefSeq ORF | 492 bp |
| Locus ID | 69270 |
| Gene Summary | Required for correct functioning of the GINS complex, a complex that plays an essential role in the initiation of DNA replication, and progression of DNA replication forks. GINS complex seems to bind preferentially to single-stranded DNA.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate splice pattern in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG223983 | Gins1 (tGFP-tagged) - Mouse GINS complex subunit 1 (Psf1 homolog) (Gins1) transcript variant 2, (10ug) |
CNY 2850.00 |
|
| MR223983 | Gins1 (Myc-DDK-tagged) - Mouse GINS complex subunit 1 (Psf1 homolog) (Gins1), transcript variant 2 |
CNY 1200.00 |
|
| MR223983L3 | Lenti ORF clone of Gins1 (Myc-DDK-tagged) - Mouse GINS complex subunit 1 (Psf1 homolog) (Gins1), transcript variant 2 |
CNY 4750.00 |
|
| MR223983L4 | Lenti ORF clone of Gins1 (mGFP-tagged) - Mouse GINS complex subunit 1 (Psf1 homolog) (Gins1), transcript variant 2 |
CNY 4750.00 |
