Selenot (NM_001040396) Mouse Untagged Clone

CAT#: MC210875

Selt (untagged) - Mouse RIKEN cDNA 2810407C02 gene (2810407C02Rik), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)



  "NM_001040396" in other vectors (2)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Synonyms 2810407C02Rik; 5730408P04Rik; Se; Selt
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210875 representing NM_001040396
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGCTCCTGCTGCTTCTGCTGGTGGCGGCGTCGGCGGTGGTCCGCAGCGAGGCCTCTGCCAACCTGG
GCGGCGTGCCCAGCAAGAGATTAAAGATGCAGTACGCCACCGGGCCGCTGCTCAAGTTCCAGATTTGTGT
ATCCTGAGGGTACCGGCGGGTGTTTGAGGAGTACATGCGGGTTATCAGCCAGCGGTATCCAGACATCCGC
ATTGAAGGCGAGAATTATCTCCCTCAACCAATTTATAGACACATAGCATCTTTCCTGTCAGTCTTCAAAC
TAGTATTAATAGGCTTAATAATTGTTGGCAAAGATCCTTTTGCTTTTTTCGGCATGCAAGCTCCTAGCAT
CTGGCAGTGGGGCCAAGAAAATAAGGTTTATGCATGTATGATGGTTTTCTTCCTGAGCAACATGATTGAG
AACCAGTGTATGTCAACAGGTGCATTTGAGATAACTTTAAATGATGTGCCAGTGTGGTCTAAGCTGGAAT
CTGGACATCTTCCATCCATGCAACAACTTGTTCAAATTCTTGACAATGAAATGAAACTCAATGTGCATAT
GGATTCAATCCCACATCATCGATCATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001040396
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
OTI Annotation This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001040396.2, NP_001035486.2
RefSeq Size 3575 bp
RefSeq ORF 588 bp
Locus ID 69227
UniProt ID P62342
Gene Summary This gene encodes a selenoprotein, containing a selenocysteine (Sec) residue at the active site. Sec is encoded by the UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. This protein is localized in the endoplasmic reticulum. It belongs to the SelWTH family that possesses a thioredoxin-like fold and a conserved CxxU (C is cysteine, U is Sec) motif found in several redox active proteins. Studies in mice indicate a crucial role for this gene in the protection of dopaminergic neurons against oxidative stress in Parkinson's disease, and in the control of glucose homeostasis in pancreatic beta-cells. A pseudogene of this locus has been identified on chromosome 8. [provided by RefSeq, Aug 2017]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...