Mrpl28 (NM_024227) Mouse Untagged Clone

CAT#: MC210762

Mrpl28 (untagged) - Mouse mitochondrial ribosomal protein L28 (Mrpl28), nuclear gene encoding mitochondrial protein, (10ug)



  "NM_024227" in other vectors (4)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110015G04Rik; L28mt; MAA; MAAT1; MRP-L28; p1; p15
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210762 representing NM_024227
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGCTGCACAGGTATCCTGTGCACCTGTGGCAGAAGCTGCGGCTGCGGCAGGGCATCTGTGCGCGCT
TGCCCGCCCACTTCTTGCGCTCACTGGAAGAAGAACGGACGCCGACCCCGGTACACTACAAACCTCACGG
GACCAAGTTCAAGATCAACCCCAAGAATGGGCAGCGCGAGCGCGTTGAGGACGTACCCATTCCAGTTCAC
TACCCTCCAGAGTCCCAGCAGGGACTGTGGGGTGGAGAGGGCTTGATTTTAGGCTACAGATACGCCAACA
ACGACAAGCTCTCCAAGAGGGTGAAGAAGGTGTGGAAGCCACAGCTGTTCACTCGGGAGCTTTACAGTGA
AATCCTGGACAAGAAGTTCACCGTGACTGTGACCATGAGGACCCTGGATCTCATCGATGAGGCCTATGGA
TTTGACTTCTATATTCTCAAGACCCCTAAGGAGGACCTGGGCTCCAAGTTTGGCATGGACCTGAAGCGAG
GGATGCTGCTGAGGCTTGCTCGCCAGGACCCCCATCTCCACCCTGAGAACCCTGAGCGGAGAGCAGCCAT
CTATGACAAGTACAGGAGCTTTGTCATCCCCGAGGCAGAGGCCGAGTGGGTTGGCCTGACGCTGGAGGAG
GCCCTGGAGAAACAGAGGCTTCTGGAGGAAAAGGACCCTGTACCCCTGTTCAAGGTCTACGTAGAGGAGC
TGGTCCAGCGGCTTCAGGAGCAGGTTCTGTCCAGGCCCGCAGTGGTGCAGAAGAGAGCCGGTGACCACGC
CTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_024227
Insert Size 774 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_024227.3, NP_077189.2
RefSeq Size 1080 bp
RefSeq ORF 774 bp
Locus ID 68611
UniProt ID Q9D1B9
Gene Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...