Nsmce2 (NM_026746) Mouse Untagged Clone
CAT#: MC210733
Nsmce2 (untagged) - Mouse non-SMC element 2 homolog (MMS21, S. cerevisiae) (Nsmce2), transcript variant 1, (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1110014D18Rik; AI661537 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC210733 representing NM_026746
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCAGGACGGTCCAGTACAAGTTCAGGTTCTACCCGTTACATATCCTTCAGTGGCATAGAGTCAGCTC TCTCCTCCTTAAAAAACTTCCAATCCTGTATCAGCTCTGGAATGGACACAGTTTCTAGTGTTGCCTTGGA CCTTGTGGAGACTCAAACTGAAGTGAGTAGTGAGTACAGTATGGACAAGGCCATGGTTGAGTTTGCTAAA ATGGATCGAGAACTAAGCCATTATGTTAAGGCTGTGCAGTCTACAATCAATCATGTAAAAGAAGAACGTC CAGAAAAAGTACCAGATTTAAAATTACTGGTAGAGAAGAAATTTTTGGCTTTACAGGATAAGAACTCTGA TGCCGACTTTAAAGAGAATGAAAAGTTCGTGCAGTTCAAGCAACAGCTGAGGGAGCTGAAGAAGCAATAT GGTATTCATGCAGACAGAGAGAATGATCTGACAGAAGGAGTTGACGAAGATATGATTGTGACCCAGAGCC AAACCAATTTCATCTGCCCCATAACACAGCTGGAAATGAAGAAGCCAGTGAAAAATAAAATGTGTGGCCA TACATACGAAGAGGAAGCCATTGTTCGCATGATTGAATCCAAGCATAAGAGGAAGAAGAAGGCCTGTTGC CCCAAAATTGGCTGTAGCCACACAGACATGAGAATGTCAGATCTCATTCCGGATGAAGCCCTGAGAAGGG CAATCGAGAGCCACAACAAGAAGAAAAAACGCCACTCCGAATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_026746 |
| Insert Size | 744 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_026746.3, NP_081022.2 |
| RefSeq Size | 1159 bp |
| RefSeq ORF | 744 bp |
| Locus ID | 68501 |
| UniProt ID | Q91VT1 |
| Gene Summary | E3 SUMO-protein ligase component of the SMC5-SMC6 complex, a complex involved in repair of DNA double-strand breaks by homologous recombination. Is not be required for the stability of the complex. The complex may promote sister chromatid homologous recombination by recruiting the SMC1-SMC3 cohesin complex to double-strand breaks. The complex is required for telomere maintenance via recombination and mediates sumoylation of shelterin complex (telosome) components. Acts as an E3 ligase mediating SUMO attachment to various proteins such as SMC6L1 and TRAX, the shelterin complex subunits TERF1, TERF2, TINF2 and TERF2IP, and maybe the cohesin components RAD21 and STAG2. Required for recruitment of telomeres to PML nuclear bodies. SUMO protein-ligase activity is required for the prevention of DNA damage-induced apoptosis by facilitating DNA repair. Required for sister chromatid cohesion during prometaphase and mitotic progression (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer variant and encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG218993 | Nsmce2 (tGFP-tagged) - Mouse non-SMC element 2 homolog (MMS21 S. cerevisiae) (Nsmce2) transcript variant 1, (10ug) |
CNY 2850.00 |
|
| MR218993 | Nsmce2 (Myc-DDK-tagged) - Mouse non-SMC element 2 homolog (MMS21, S. cerevisiae) (Nsmce2), transcript variant 1 |
CNY 2400.00 |
|
| MR218993L3 | Lenti ORF clone of Nsmce2 (Myc-DDK-tagged) - Mouse non-SMC element 2 homolog (MMS21, S. cerevisiae) (Nsmce2), transcript variant 1 |
CNY 4750.00 |
|
| MR218993L4 | Lenti ORF clone of Nsmce2 (mGFP-tagged) - Mouse non-SMC element 2 homolog (MMS21, S. cerevisiae) (Nsmce2), transcript variant 1 |
CNY 4750.00 |
