Sdhaf1 (NM_001033140) Mouse Untagged Clone
CAT#: MC210719
Sdhaf1 (untagged) - Mouse succinate dehydrogenase complex assembly factor 1 (Sdhaf1), nuclear gene encoding mitochondrial protein, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 0610010E21Rik; AI430885; AW490662; Lyrm8 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210719 representing NM_001033140
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCCGGCCCAGCCGGTTGCAGAGGCAAGTTCTGAGCCTGTACCGCGAGCTGCTGCGCGCCGGGCGCG GGACGCCGGGCGCCGAGGCGCGGGTGCGGGCCGAGTTCCGGCAGCACGCCAGCCTTCCGCGAACCGACGT GCTGCGTATCGAGTATCTGTATCGCCGGGGTCGGCGCCAGCTACAGCTGCTGCGTTCGGGCCACGCCACG GCCATGGGTACCTTCGTGCGCCCGCGGGGTCCGGCTGAAGAGCCCGGCGACGCGACAGCCCCGGGGACCA GGCTGGATGATGGTGGTGCCCCAAAGAATTCTTGTGAAGATACAGGGGCGCGGGAGACGCGATCCGATGG ACGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001033140 |
Insert Size | 357 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001033140.3, NP_001028312.2 |
RefSeq Size | 987 bp |
RefSeq ORF | 357 bp |
Locus ID | 68332 |
UniProt ID | Q3U276 |
Gene Summary | Plays an essential role in the assembly of succinate dehydrogenase (SDH), an enzyme complex (also referred to as respiratory complex II) that is a component of both the tricarboxylic acid (TCA) cycle and the mitochondrial electron transport chain, and which couples the oxidation of succinate to fumarate with the reduction of ubiquinone (coenzyme Q) to ubiquinol. Promotes maturation of the iron-sulfur protein subunit Sdhb of the SDH catalytic dimer, protecting it from the deleterious effects of oxidants. May act together with SDHAF3. Contributes to iron-sulfur cluster incorporation into SDHB by binding to SDHB and recruiting the iron-sulfur transfer complex formed by HSC20, HSPA9 and ISCU through direct binding to HSC20.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224575 | Sdhaf1 (tGFP-tagged) - Mouse succinate dehydrogenase complex assembly factor 1 (Sdhaf1) nuclear gene encoding mitochondrial protein, (10ug) |
CNY 2090.00 |
|
MR224575 | Sdhaf1 (Myc-DDK-tagged) - Mouse succinate dehydrogenase complex assembly factor 1 (Sdhaf1), nuclear gene encoding mitochondrial protein |
CNY 1900.00 |
|
MR224575L3 | Lenti ORF clone of Sdhaf1 (Myc-DDK-tagged) - Mouse succinate dehydrogenase complex assembly factor 1 (Sdhaf1), nuclear gene encoding mitochondrial protein |
CNY 3800.00 |
|
MR224575L4 | Lenti ORF clone of Sdhaf1 (mGFP-tagged) - Mouse succinate dehydrogenase complex assembly factor 1 (Sdhaf1), nuclear gene encoding mitochondrial protein |
CNY 3800.00 |