Coa6 (NM_174987) Mouse Untagged Clone
CAT#: MC210647
Coa6 (untagged) - Mouse RIKEN cDNA 1810063B05 gene (1810063B05Rik), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1810063B05Rik; AI447995 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210647 representing NM_174987
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGCCCCTTCCATGAAGGAAAGGCAGGCATGCTGGGGTGCGCGCGACCTGTACTGGCGCTGCCTGG ACGACAACGCGGAGGACGCGGCCCGGTGCCAGAAGCTGAGGAGCTCGTTCGAGGCCAGCTGCCCCCAGCA GTGGATAAAATATTTTGACAAAAGAAGAGACTACTTAAAATTCAAGGAAAAATTTGAAGCAGGAGGATTC CAGTCTTCACAGTCGACTGAAAATTCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_174987 |
Insert Size | 240 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_174987.4, NP_778152.1 |
RefSeq Size | 780 bp |
RefSeq ORF | 240 bp |
Locus ID | 67892 |
UniProt ID | Q8BGD8 |
Gene Summary | Involved in the maturation of the mitochondrial respiratory chain complex IV subunit MT-CO2/COX2. Thereby, may regulate early steps of complex IV assembly. Mitochondrial respiratory chain complex IV or cytochrome c oxidase is the component of the respiratory chain that catalyzes the transfer of electrons from intermembrane space cytochrome c to molecular oxygen in the matrix and as a consequence contributes to the proton gradient involved in mitochondrial ATP synthesis. May also be required for efficient formation of respiratory supercomplexes comprised of complexes III and IV.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200127 | Coa6 (tGFP-tagged) - Mouse RIKEN cDNA 1810063B05 gene (1810063B05Rik) |
CNY 2850.00 |
|
MR200127 | Coa6 (Myc-DDK-tagged) - Mouse RIKEN cDNA 1810063B05 gene (1810063B05Rik) |
CNY 1200.00 |
|
MR200127L3 | Lenti ORF clone of Coa6 (Myc-DDK-tagged) - Mouse RIKEN cDNA 1810063B05 gene (1810063B05Rik) |
CNY 4750.00 |
|
MR200127L4 | Lenti ORF clone of Coa6 (mGFP-tagged) - Mouse RIKEN cDNA 1810063B05 gene (1810063B05Rik) |
CNY 4750.00 |