Dnajc19 (NM_026332) Mouse Untagged Clone
CAT#: MC210607
Dnajc19 (untagged) - Mouse DnaJ (Hsp40) homolog, subfamily C, member 19 (Dnajc19), transcript variant 1, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1810055D05Rik; AA959924; Tim14 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210607 representing NM_026332
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCAGCACAGTGGTAGCAGTCGGGTTGACCATTGCTGCTGCAGGATTTGCAGGCCGTTATGTTTTAC AAGCCATGAAGCATGTGGAGCCTCAAGTAAAACAAGTTTTTCAGAGCCTACCAAAATCTGCATTCGGTGG TGGGTACTACAGAGGTGGATTTGAACCCAAAATGACAAAACGGGAAGCAGCATTAATATTAGGTGTAAGC CCTACTGCCAATAAAGGGAAGATCAGGGATGCTCATCGCCGGATTATGCTATTAAATCACCCAGACAAGG GAGGATCTCCTTATATAGCAGCCAAAATCAATGAAGCTAAAGACTTACTAGAAGGACAAGCTAAAAAATA A ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_026332 |
Insert Size | 351 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_026332.4, NP_080608.3 |
RefSeq Size | 686 bp |
RefSeq ORF | 351 bp |
Locus ID | 67713 |
UniProt ID | Q9CQV7 |
Gene Summary | Probable component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner. May act as a co-chaperone that stimulate the ATP-dependent activity (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) uses an alternate 3' terminal exon which results in a frameshift compared to variant 2. The resulting protein (isoform 1) has a distinct C-terminus and is shorter than isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG217801 | Dnajc19 (tGFP-tagged) - Mouse DnaJ (Hsp40) homolog subfamily C member 19 (Dnajc19) transcript variant 1, (10ug) |
CNY 2090.00 |
|
MR217801 | Dnajc19 (Myc-DDK-tagged) - Mouse DnaJ (Hsp40) homolog, subfamily C, member 19 (Dnajc19), transcript variant 1 |
CNY 1900.00 |
|
MR217801L3 | Lenti ORF clone of Dnajc19 (Myc-DDK-tagged) - Mouse DnaJ (Hsp40) homolog, subfamily C, member 19 (Dnajc19), transcript variant 1 |
CNY 3800.00 |
|
MR217801L4 | Lenti ORF clone of Dnajc19 (mGFP-tagged) - Mouse DnaJ (Hsp40) homolog, subfamily C, member 19 (Dnajc19), transcript variant 1 |
CNY 3800.00 |
其它Dnajc19产品