Spc24 (NM_026282) Mouse Untagged Clone
CAT#: MC210586
Spc24 (untagged) - Mouse SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) (Spc24), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2410030K01Rik; AV109292; Spbc24 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210586 representing NM_026282
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGCTTTCCGCGACATGGTGGAGGTGAGCAACTGGCTACTGAGCCTGCTGGGGGCCAACCGCGCCG AGGCGCAGCAGCGGCGGCTGCTCGGGAGCTACGAGCAGATGATGGAGCGGCTGCTGGAGATGCAGGACGG CGCCTACCGGCAGCTTCGGGAGACTCTGGCTGTGGAGGAGGAAGTGGCTCAGAGCCTTCTTGAACTGAAA GAATGTACGCGCCAGGGGGACACCGAGCTGCAGCAGCTGGAGGTGGAGCTCCAGAGGACCAGCAAGGAGG ACACCTGTGTGCAGGCTAGGCTACGTCAGCTCATCACAGAGCTGCAGGAGCTCAGGGAGATGGAGGAAGA GCTCCAGCGCCAGGAGAGGGATGTAGATGAGGACAACACCGTCACCATCCCCTCTGCAGTGTATGTGGCT CATCTCTATCACCAAATTAGTAAAATACAGTGGGATTATGAATGCGAGCCAGGGATGATCAAGGGCATCC ACCACGGCCCCACAGTGGCCCAGCCCATCCACTTGGACAGTGCACAGCTCTCGCCGAAGTTCATCAGTGA CTACCTCTGGAGCCTGGTGGACACCACGTGGGAGCCAGAGCCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_026282 |
Insert Size | 606 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_026282.5, NP_080558.1 |
RefSeq Size | 1349 bp |
RefSeq ORF | 606 bp |
Locus ID | 67629 |
UniProt ID | Q9D083 |
Gene Summary | Acts as a component of the essential kinetochore-associated NDC80 complex, which is required for chromosome segregation and spindle checkpoint activity. Required for kinetochore integrity and the organization of stable microtubule binding sites in the outer plate of the kinetochore. The NDC80 complex synergistically enhances the affinity of the SKA1 complex for microtubules and may allow the NDC80 complex to track depolymerizing microtubules.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG218082 | Spc24 (tGFP-tagged) - Mouse SPC24 NDC80 kinetochore complex component homolog (S. cerevisiae) (Spc24), (10ug) |
CNY 2850.00 |
|
MR218082 | Spc24 (Myc-DDK-tagged) - Mouse SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) (Spc24) |
CNY 2400.00 |
|
MR218082L3 | Lenti ORF clone of Spc24 (Myc-DDK-tagged) - Mouse SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) (Spc24) |
CNY 4750.00 |
|
MR218082L4 | Lenti ORF clone of Spc24 (mGFP-tagged) - Mouse SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) (Spc24) |
CNY 4750.00 |