Nudt16l1 (NM_025839) Mouse Untagged Clone

CAT#: MC210452

Nudt16l1 (untagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1 (Nudt16l1), (10ug)



  "NM_025839" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110001K21Rik; 5330437I08Rik; Sdos
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210452 representing NM_025839
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGACCACGACGGTTCCGGAGCTGAAACAGATCAGTCGGGAGGAAGCAATGCGCTTGGGGCCCGGCT
GGAGTCATTCATGCCACGCCATGCTATACGCCGCCAACCCCGGGCAGCTTTTCGGACGTATCCCCATGCG
TTTCTCAGTGCTGATGCAGATGCGCTTCGACGGGCTGCTAGGCTTTCCCGGGGGTTTCGTGGACCGGCGC
TTCTGGTCGCTGGAGGATGGCTTGAATCGGGTGCTGGGCCTGGGCCTGGGCGGCCTACGCCTTACCGAAG
CTGATTACCTGAGTTCACACCTGACTGAGGGTCCACACCGTGTGGTGGCACATCTGTACGCACGGCAGCT
GACATTGGAACAACTGCATGCTGTGGAGATCAGCGCTGTGCACTCACGGGACCACGGTCTGGAGGTCCTG
GGCCTTGTACGGGTCCCACTGTACACACAGAAGGATCGAGTAGGCGGCTTTCCTAACTTTCTGAGCAACG
CCTTCGTCAGCACTGCCAAATATCAACTTCTATTTGCCCTTAAGGTACTCAACATGATGCCCTCGGAAAA
GCTGGCCGAGGCCTTGGCCTCAGCAACAGAGAAGCAGAAGAAGGCTCTAGAAAAGCTGCTCCCGCCCTCA
TCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_025839
Insert Size 636 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_025839.4, NP_080115.1
RefSeq Size 1294 bp
RefSeq ORF 636 bp
Locus ID 66911
UniProt ID Q8VHN8
Gene Summary Key regulator of TP53BP1 required to stabilize TP53BP1 and regulate its recruitment to chromatin. In absence of DNA damage, interacts with the tandem Tudor-like domain of TP53BP1, masking the region that binds histone H4 dimethylated at 'Lys-20' (H4K20me2), thereby preventing TP53BP1 recruitment to chromatin and maintaining TP53BP1 localization to the nucleus. Following DNA damage, ATM-induced phosphorylation of TP53BP1 and subsequent recruitment of RIF1 leads to dissociate NUDT16L1/TIRR from TP53BP1, unmasking the tandem Tudor-like domain and allowing recruitment of TP53BP1 to DNA double strand breaks (DSBs). Binds U8 snoRNA.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...