Hamp2 (NM_183257) Mouse Untagged Clone
CAT#: MC210367
Hamp2 (untagged) - Mouse hepcidin antimicrobial peptide 2 (Hamp2), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1810073K19Rik; HEPC; HEPC2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210367 representing NM_183257
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGGCACTCAGCACTCGGACCCAGGCTGCCTGTCTCCTGCTTCTCCTCCTTGCCAGCCTGAGCAGCA CCACCTATCTCCAGCAACAGATGAGACAGACTACAGAGCTGCAGCCTTTGCACGGGGAAGAAAGCAGGGC AGACATTGCGATCCCAATGCAGAAGAGAAGGAAGAGAGACATCAACTTCCCCATCTGCAGATTCTGCTGT CAGTGCTGTAACAAACCCTCCTGTGGTATCTGTTGTGAAGAATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_183257 |
Insert Size | 255 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_183257.3, NP_899080.1 |
RefSeq Size | 439 bp |
RefSeq ORF | 252 bp |
Locus ID | 66438 |
UniProt ID | Q80T19 |
Gene Summary | This gene encodes a peptide hormone that functions in the regulation of systemic iron metabolism. The encoded preproprotein is synthesized in the hepatocytes where it undergoes proteolytic processing to generate disulfide-linked mature peptides that are secreted into the bloodstream. Transgenic mice overexpressing the encoded protein develop normally with hematologic parameters similar to the non-transgenic mice. This gene is located adjacent to a related hepcidin gene on chromosome 7. [provided by RefSeq, Aug 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG220504 | Hamp2 (tGFP-tagged) - Mouse hepcidin antimicrobial peptide 2 (Hamp2), (10ug) |
CNY 2800.00 |
|
MR220504 | Hamp2 (Myc-DDK-tagged) - Mouse hepcidin antimicrobial peptide 2 (Hamp2) |
CNY 1200.00 |
|
MR220504L3 | Lenti ORF clone of Hamp2 (Myc-DDK-tagged) - Mouse hepcidin antimicrobial peptide 2 (Hamp2) |
CNY 4750.00 |
|
MR220504L4 | Lenti ORF clone of Hamp2 (mGFP-tagged) - Mouse hepcidin antimicrobial peptide 2 (Hamp2) |
CNY 4750.00 |