Cox16 (NM_025461) Mouse Untagged Clone
CAT#: MC210315
Cox16 (untagged) - Mouse COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) (Cox16), nuclear gene encoding mitochondrial protein, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1810020G14Rik; 1810055I05Rik; BB388670 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210315 representing NM_025461
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATTGCGCCCGCTGTGTTGCGAGCTCTGCGTAAGAACAAGACTCTACGCTATGGAGTTCCCATGTTGT TGCTGGTTGTTGGAGGTTCTTTTGGTCTTCGTGAATTTTCACAAATCCGGTACGATGCTGTGACAATTAA GATTGATCCTGAATTGGAGAAAAAATTGAAAGTGAATAAAATAACTTTAGAGTCAGAGTATGAGAAAATA AAGGACTCCACTTTTGAAAACTGGAAGAATATTCGAGGTCCGAGGCCTTGGGAAGATCCTCAACTCCTCC AAGGACGAAACCCAGAAACTCTTAAGCCTAAGACAACCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_025461 |
Insert Size | 321 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_025461.6, NP_079737.1 |
RefSeq Size | 2125 bp |
RefSeq ORF | 321 bp |
Locus ID | 66272 |
UniProt ID | Q9CR63 |
Gene Summary | Required for the assembly of the mitochondrial respiratory chain complex IV (CIV), also known as cytochrome c oxidase. Promotes the insertion of copper into the active site of cytochrome c oxidase subunit II (MT-CO2/COX2). Interacts specifically with newly synthesized MT-CO2/COX and its copper center-forming metallochaperones SCO1, SCO2 and COA6. Probably facilitates MT-CO2/COX2 association with the MITRAC assembly intermediate containing MT-CO1/COX1, thereby participating in merging the MT-CO1/COX1 and MT-CO2/COX2 assembly lines.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG218609 | Cox16 (tGFP-tagged) - Mouse COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) (Cox16), (10ug) |
CNY 2850.00 |
|
MR218609 | Cox16 (Myc-DDK-tagged) - Mouse COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) (Cox16), nuclear gene encoding mitochondrial protein |
CNY 1200.00 |
|
MR218609L3 | Lenti ORF clone of Cox16 (Myc-DDK-tagged) - Mouse COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) (Cox16), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
|
MR218609L4 | Lenti ORF clone of Cox16 (mGFP-tagged) - Mouse COX16 cytochrome c oxidase assembly homolog (S. cerevisiae) (Cox16), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |