Pigyl (NM_001082532) Mouse Untagged Clone
CAT＃: MC210313
Pigyl (untagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class Y-like (Pigyl), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1810008A14Rik; PIG-Y; Pigy |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC210313 representing NM_001082532
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATCCGGTCCCTGCCCACCATGACCGTCCTCATCCCACTGGTCTCGCTGGCAGGCCTGCTCTACTCCG CCTCCGTGGAGGAAGGCTTCCCAGAGGGCTGCACCAGCGCCAGCAGCCTGTGCTTCTACAGCTTGCTCTT GCCGGTCACCGTGCCTGTGTACGTGTTCTTCCATCTGTGGACATGGATGGGCCTGAAGCTCTTCAGACAT AACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001082532 |
| Insert Size | 216 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001082532.1, NP_001076001.1 |
| RefSeq Size | 692 bp |
| RefSeq ORF | 216 bp |
| Locus ID | 66268 |
| UniProt ID | P0C1P0 |
| Gene Summary | This gene encodes a homolog of a human protein that functions in glycosylphosphatidylinositol biosynthesis. The human protein is expressed from an unusual locus that encodes two distinct proteins in upstream and downstream CDSes; however, in mouse these two proteins are expressed from distinct loci. The product of this locus is highly similar to the protein expressed from the human downstream CDS. A separate mouse locus on chromosome 6 is orthologous to the human locus and encodes a protein similar to the human protein expressed from the upstream CDS. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG217923 | Pigyl (tGFP-tagged) - Mouse phosphatidylinositol glycan anchor biosynthesis class Y-like (Pigyl), (10ug) |
CNY 2090.00 |
|
| MR217923 | Pigyl (Myc-DDK-tagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class Y-like (Pigyl) |
CNY 1900.00 |
|
| MR217923L3 | Lenti ORF clone of Pigyl (Myc-DDK-tagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class Y-like (Pigyl) |
CNY 3800.00 |
|
| MR217923L4 | Lenti ORF clone of Pigyl (mGFP-tagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class Y-like (Pigyl) |
CNY 3800.00 |
