S100a14 (NM_001163525) Mouse Untagged Clone
CAT#: MC210290
S100a14 (untagged) - Mouse S100 calcium binding protein A14 (S100a14), transcript variant 1, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110013O05Rik; S100a15; S114 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210290 representing NM_001163525
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGACAGTGTCGGTCAGCCAATGCTGAGGATGCCCAAGAATTCAGTGATGTAGAGAGGGCCATTGAGA CACTCATCAAGAACTTCCATAAATACTCTGTGGCGGGTAAAAAGGAAACACTGACCCCTGCTGAGCTTCG AGACCTGGTTACCCAGCAGCTGCCACACCTCATGCCGAGCAACTGTGGGTTAGAAGAGAAAATTGCCAAC CTGGGCAACTGTAATGACTCGAAACTGGAGTTTGGAAGCTTCTGGGAGTTGATTGGAGAAGCAGCCAAGA GTGTGAAGATGGAGAGGCCTGTTACTCGGAGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001163525 |
Insert Size | 315 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001163525.2, NP_001156997.1 |
RefSeq Size | 1097 bp |
RefSeq ORF | 315 bp |
Locus ID | 66166 |
UniProt ID | Q9D2Q8 |
Gene Summary | Modulates P53/TP53 protein levels, and thereby plays a role in the regulation of cell survival and apoptosis. Depending on the context, it can promote cell proliferation or apoptosis. Plays a role in the regulation of cell migration by modulating the levels of MMP2, a matrix protease that is under transcriptional control of P53/TP53. Does not bind calcium (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 2 both encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG221787 | S100a14 (tGFP-tagged) - Mouse S100 calcium binding protein A14 (S100a14) transcript variant 1, (10ug) |
CNY 2090.00 |
|
MR221787 | S100a14 (Myc-DDK-tagged) - Mouse S100 calcium binding protein A14 (S100a14), transcript variant 1 |
CNY 1900.00 |
|
MR221787L3 | Lenti ORF clone of S100a14 (Myc-DDK-tagged) - Mouse S100 calcium binding protein A14 (S100a14), transcript variant 1 |
CNY 3800.00 |
|
MR221787L4 | Lenti ORF clone of S100a14 (mGFP-tagged) - Mouse S100 calcium binding protein A14 (S100a14), transcript variant 1 |
CNY 3800.00 |
其它S100a14产品