Ska2 (NM_025377) Mouse Untagged Clone
CAT#: MC210282
Ska2 (untagged) - Mouse family with sequence similarity 33, member A (Fam33a), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1110001A07Rik; C78640; Fam33a |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC210282 representing NM_025377
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGGCGGAGGTCGATAAGCTGGAACTGATGTTCCAGAAAGCTGATTCTGATTTGGATTACCTTCAAT ATAGGCTGGAATATGAAGTCAAGACTAATCACCCACATTCAGCAGGAGAGAAAAATGCAGTTACAGTTTT AAAGGAATTATCAGCGATAAAGTCTCGCTATCAAGCTTTATGTGCACGCTTTAAGGCAGTTTCTGTTGAG CAAAAGGAGACCAAGAGCTGCATTTGTGCTACTTTGAACAAGACAATGACCATGATACAAGAACTACAAA AGCAAACAAACCTGGAGCTAACTCTACTGACTGAAGAAGAGAAAGCTGCAACAGAGCCATTAAAATCTCA TATGCCGGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_025377 |
| Insert Size | 363 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_025377.3, NP_079653.1 |
| RefSeq Size | 1349 bp |
| RefSeq ORF | 363 bp |
| Locus ID | 66140 |
| UniProt ID | Q9CR46 |
| Gene Summary | Component of the SKA1 complex, a microtubule-binding subcomplex of the outer kinetochore that is essential for proper chromosome segregation. Required for timely anaphase onset during mitosis, when chromosomes undergo bipolar attachment on spindle microtubules leading to silencing of the spindle checkpoint. The SKA1 complex is a direct component of the kinetochore-microtubule interface and directly associates with microtubules as oligomeric assemblies. The complex facilitates the processive movement of microspheres along a microtubule in a depolymerization-coupled manner. In the complex, it is required for SKA1 localization. Affinity for microtubules is synergistically enhanced in the presence of the ndc-80 complex and may allow the ndc-80 complex to track depolymerizing microtubules.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG223354 | Ska2 (tGFP-tagged) - Mouse family with sequence similarity 33 member A (Fam33a), (10ug) |
CNY 2850.00 |
|
| MR223354 | Ska2 (Myc-DDK-tagged) - Mouse family with sequence similarity 33, member A (Fam33a) |
CNY 1200.00 |
|
| MR223354L3 | Lenti ORF clone of Ska2 (Myc-DDK-tagged) - Mouse family with sequence similarity 33, member A (Fam33a) |
CNY 4750.00 |
|
| MR223354L4 | Lenti ORF clone of Ska2 (mGFP-tagged) - Mouse family with sequence similarity 33, member A (Fam33a) |
CNY 4750.00 |
