Tbata (NM_023064) Mouse Untagged Clone
CAT#: MC210245
Tbata (untagged) - Mouse thymus, brain and testes associated (Tbata), transcript variant 3, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1700021K02Rik; AI428928; S; Spatial; Titest |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210245 representing NM_023064
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC CTGTTTCTGGGGAATGTATATAAGGGGAGTTTAGCACCTCGTAGGGATGAGGTGACTAGTCCAAAGGCAG AGCCCCAGCCAGAGACGAAGCCGGAGAACCTTCCAAGGAGCCACGGGGATGTTGGGCTCCAGAAAGAGAC TGTGGTCCCAGGCATTGTGGATTTCGAGCTGATCCATGAGGAGCTGAAGACCACAAAGCCCCAAACATCA CAACCAACACCCAGTGCCTACCGCTTTGGACGCCTAAGCCACCATTCCTTCTTCTCGAGGCACCACCCCC AACCACAGCGAGTGACTCATATCCAAGTTACAGGAAGAGAGGACCTGGAGCACTCCCTGCCCCTCACCAC CTCTTTCCAGCTCCTTCAAGCTCCTGGGGTCCAGCCCATGGATCTCACTCCCTCTGCAGATATCGCTGGG AAGCCTGTCTGCGTGGTCAGGGACGAGTTCTCTCTGTCGGCCTTGACTCAGCCCACATTCTTATCCCGCT GTCTGATGGGGATGCCCACCATCTCTGTCCCCATTGGGGATCCACAGTCCAATCGGAACCCCCAGCTTTC TACTTCTGACACCTGGAGGAAGAAACTGAAGGACCTGGCTTCCCGAGTGACTGTCTTCACTAAGGAAATC CAGCCAAAGCCCGATGAGGTTGGTGTTGCACAAAGAATGGAGCCTAGAAAAAAAAGGCCTTCTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_023064 |
Insert Size | 696 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_023064.3, NP_075551.3 |
RefSeq Size | 1034 bp |
RefSeq ORF | 696 bp |
Locus ID | 65971 |
UniProt ID | Q7TSD4 |
Gene Summary | This gene encodes a putative transcription factor that is highly expressed in thymic cortical stromal cells, and may be involved in T-cell development. Its expression is developmentally regulated in the testis, where it is restricted to the haploid round spermatids during spermatogenesis, and thus this gene may also have a role in the control of male germ cell development. Alternative splicing of this gene results in two sets of transcript variants: the variants containing 5 additional exons at the 3' end encode long isoforms that are highly expressed in the testis, while the variants lacking the 3' end exons encode short isoforms that are highly expressed in the thymus. Most of the transcripts encoding the short isoforms have been shown to initiate translation from non-AUG (CUG) start sites. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) encodes the longest of the short isoforms (3, also known as Spatial-alpha). It initiates translation from a non-AUG (CUG) start site and is highly expressed in the thymus. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223783 | Tbata (tGFP-tagged) - Mouse thymus brain and testes associated (Tbata) transcript variant 3, (10ug) |
CNY 2470.00 |
|
MR223783 | Tbata (Myc-DDK-tagged) - Mouse thymus, brain and testes associated (Tbata), transcript variant 3 |
CNY 2280.00 |
|
MR223783L3 | Lenti ORF clone of Tbata (Myc-DDK-tagged) - Mouse thymus, brain and testes associated (Tbata), transcript variant 3 |
CNY 4180.00 |
|
MR223783L4 | Lenti ORF clone of Tbata (mGFP-tagged) - Mouse thymus, brain and testes associated (Tbata), transcript variant 3 |
CNY 4180.00 |