Il1f5 (NM_001146088) Mouse Untagged Clone
CAT#: MC209982
Il1f5 (untagged) - Mouse interleukin 1 family, member 5 (delta) (Il1f5), transcript variant 3, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI413231; Fil1delta; Il-1h3; IL-36Ra; Il1hy1; IL36RN |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209982 representing NM_001146088
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGGTTCTGAGTGGGGCACTATGCTTCCGAATGAAGGATTCAGCCTTGAAGGTACTGTATCTGCACA ATAACCAGCTGCTGGCTGGAGGACTGCACGCAGAGAAGGTCATTAAAGGTGAGGAGATCAGTGTTGTCCC AAATCGGGCACTGGATGCCAGTCTGTCCCCTGTCATCCTGGGCGTTCAAGGAGGAAGCCAGTGCCTATCT TGTGGGACAGAGAAAGGGCCAATTCTGAAACTTGAGCCAGTGAACATCATGGAGCTCTACCTCGGGGCCA AGGAATCAAAGAGCTTCACCTTCTACCGGCGGGATATGGGTCTTACCTCCAGCTTCGAATCCGCTGCCTA CCCAGGCTGGTTCCTCTGCACCTCACCGGAAGCTGACCAGCCTGTCAGGCTCACTCAGATCCCTGAGGAC CCCGCCTGGGATGCTCCCATCACAGACTTCTACTTTCAGCAGTGTGACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001146088 |
Insert Size | 471 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001146088.1, NP_001139560.1 |
RefSeq Size | 1722 bp |
RefSeq ORF | 471 bp |
Locus ID | 54450 |
UniProt ID | Q9QYY1 |
Gene Summary | Inhibits the activity of interleukin-36 (IL36A,IL36B and IL36G) by binding to receptor IL1RL2/IL-36R and preventing its association with the coreceptor IL1RAP for signaling. Part of the IL-36 signaling system that is thought to be present in epithelial barriers and to take part in local inflammatory response; similar to the IL-1 system with which it shares the coreceptor. Proposed to play a role in skin inflammation. May be involved in the innate immune response to fungal pathogens. May activate an anti-inflammatory signaling pathway by recruiting SIGIRR.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG219405 | Il1f5 (tGFP-tagged) - Mouse interleukin 1 family member 5 (delta) (Il1f5) transcript variant 3, (10ug) |
CNY 2850.00 |
|
MR219405 | Il1f5 (Myc-DDK-tagged) - Mouse interleukin 1 family, member 5 (delta) (Il1f5), transcript variant 3 |
CNY 1200.00 |
|
MR219405L3 | Lenti ORF clone of Il1f5 (Myc-DDK-tagged) - Mouse interleukin 1 family, member 5 (delta) (Il1f5), transcript variant 3 |
CNY 4750.00 |
|
MR219405L4 | Lenti ORF clone of Il1f5 (mGFP-tagged) - Mouse interleukin 1 family, member 5 (delta) (Il1f5), transcript variant 3 |
CNY 4750.00 |