Hnrnpa2b1 (NM_182650) Mouse Untagged Clone

CAT#: MC209933

Hnrnpa2b1 (untagged) - Mouse heterogeneous nuclear ribonucleoprotein A2/B1 (Hnrnpa2b1), transcript variant 2, (10ug)



  "NM_182650" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
HNRNPA2B1 Antibody - C-terminal region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 9130414A06Rik; hnrnp-A; Hnrpa2; Hnrpa2b1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209933 representing NM_182650
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGAGAGAAAAGGAACAGTTCCGAAAGCTCTTTATTGGTGGCTTAAGCTTTGAAACCACAGAAGAAA
GTTTGAGAAACTACTATGAGCAATGGGGAAAGCTCACAGACTGTGTGGTTATGCGGGATCCTGCAAGCAA
AAGATCAAGAGGATTTGGCTTTGTAACTTTCTCATCCATGGCCGAGGTTGACGCTGCCATGGCTGCAAGG
CCCCATTCCATTGATGGCAGGGTAGTTGAGCCAAAACGTGCTGTAGCAAGAGAGGAGTCTGGAAAACCAG
GAGCCCATGTGACTGTGAAGAAGCTGTTTGTTGGTGGAATTAAGGAAGATACTGAGGAACACCACCTTAG
AGATTACTTTGAAGAGTATGGAAAAATTGATACTATTGAAATAATTACCGATAGGCAGTCTGGAAAGAAA
AGAGGCTTTGGCTTTGTTACTTTTGATGACCATGATCCTGTGGATAAAATTGTCTTGCAAAAATATCACA
CCATAAATGGTCACAATGCAGAAGTTAGAAAGGCATTGTCTAGACAAGAAATGCAGGAAGTCCAAAGTTC
TAGGAGTGGAAGAGGAGGAAACTTTGGTTTTGGGGATTCTCGTGGTGGCGGTGGCAATTTTGGACCAGGA
CCAGGAAGCAACTTTAGGGGGGGATCTGATGGATACGGAAGTGGACGTGGATTTGGGGATGGCTATAATG
GGTATGGAGGAGGACCTGGAGGAAATTATGGAAGTGGAAGTTACAATGATTTTGGAAATTATAACCAGCA
GCCTTCTAACTATGGTCCAATGAAGAGTGGAAACTTTGGGGGTAGCAGGAACATGGGAGGACCATATGGT
GGAGGGAACTATGGTCCTGGAGGAAGTGGAGGAAGTGGTGGCTATGGTGGAAGGAGCAGATATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_182650
Insert Size 906 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_182650.4, NP_872591.1
RefSeq Size 2145 bp
RefSeq ORF 906 bp
Locus ID 53379
UniProt ID O88569
Gene Summary Heterogeneous nuclear ribonucleoprotein (hnRNP) that associates with nascent pre-mRNAs, packaging them into hnRNP particles. The hnRNP particle arrangement on nascent hnRNA is non-random and sequence-dependent and serves to condense and stabilize the transcripts and minimize tangling and knotting. Packaging plays a role in various processes such as transcription, pre-mRNA processing, RNA nuclear export, subcellular location, mRNA translation and stability of mature mRNAs. Forms hnRNP particles with at least 20 other different hnRNP and heterogeneous nuclear RNA in the nucleus. Involved in transport of specific mRNAs to the cytoplasm in oligodendrocytes and neurons: acts by specifically recognizing and binding the A2RE (21 nucleotide hnRNP A2 response element) or the A2RE11 (derivative 11 nucleotide oligonucleotide) sequence motifs present on some mRNAs, and promotes their transport to the cytoplasm (By similarity). Specifically binds single-stranded telomeric DNA sequences, protecting telomeric DNA repeat against endonuclease digestion (By similarity). Also binds other RNA molecules, such as primary miRNA (pri-miRNAs): acts as a nuclear 'reader' of the N6-methyladenosine (m6A) mark by specifically recognizing and binding a subset of nuclear m6A-containing pri-miRNAs. Binding to m6A-containing pri-miRNAs promotes pri-miRNA processing by enhancing binding of DGCR8 to pri-miRNA transcripts. Involved in miRNA sorting into exosomes following sumoylation, possibly by binding (m6A)-containing pre-miRNAs. Acts as a regulator of efficiency of mRNA splicing, possibly by binding to m6A-containing pre-mRNAs (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. It encodes isoform 2, which lacks an internal segment and is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...