Lair1 (NM_178611) Mouse Untagged Clone

CAT#: MC209916

Lair1 (untagged) - Mouse leukocyte-associated Ig-like receptor 1 (Lair1), transcript variant b, (10ug)



  "NM_178611" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 5133400O11Rik; BB115266; D7Bwg0421e; Lair-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209916 representing NM_178611
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCACTTCATCCAGTTATCCTGCTGGTGCTTGTGCTGTGCCTGGGATGGAAAATTAACACACAGGAGG
ATACATCTTGGCTAAAGACATACAGCATTTACATTTTTACTGTGGTCTCTGTGATTTTCCTCCTTTGTCT
TTCCGCCCTTCTGTTCTGCTTCCTCAGGCACCGTCAGAAAAAGCAGGGACTCCCAAACAACAAAAGACAG
CAGCAGAGGCCAGAAGAGAGGCTAAATCTAGCTACTAATGGCCTGGAGATGACTCCAGACATAGTTGCAG
ATGACAGGCTTCCTGAGGACAGATGGACAGAAACCTGGACCCCAGTTGCAGGAGACCTTCAAGAGGTGAC
GTATATCCAGCTGGACCATCACTCCCTCACACAGAGGGCAGTCGGAGCTGTGACCTCACAGAGCACAGAT
ATGGCTGAGTCCAGCACATATGCAGCCATCATCAGACACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_178611
Insert Size 462 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_178611.6, NP_848726.1
RefSeq Size 3182 bp
RefSeq ORF 462 bp
Locus ID 52855
UniProt ID Q8BG84
Gene Summary Functions as an inhibitory receptor that plays a constitutive negative regulatory role on cytolytic function of natural killer (NK) cells, B-cells and T-cells. Activation by Tyr phosphorylation results in recruitment and activation of the phosphatases PTPN6 and PTPN11. It also reduces the increase of intracellular calcium evoked by B-cell receptor ligation. May also play its inhibitory role independently of SH2-containing phosphatases. Modulates cytokine production in CD4+ T-cells, down-regulating IL2 and IFNG production while inducing secretion of transforming growth factor beta. Down-regulates also IgG and IgE production in B-cells as well as IL8, IL10 and TNF secretion. Inhibits proliferation and induces apoptosis in myeloid leukemia cell lines as well as prevents nuclear translocation of NF-kappa-B p65 subunit/RELA and phosphorylation of I-kappa-B alpha/CHUK in these cells. Inhibits the differentiation of peripheral blood precursors towards dendritic cells (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (b) lacks an in-frame exon in the coding region compared to variant a. It encodes isoform b, which is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...