Sirt6 (NM_001163430) Mouse Untagged Clone
CAT#: MC209860
Sirt6 (untagged) - Mouse sirtuin 6 (silent mating type information regulation 2, homolog) 6 (S. cerevisiae) (Sirt6), transcript variant 2, (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2810449N18Rik; AI043036; Sir2l6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209860 representing NM_001163430
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGGCAGTCCTCCAGCGTGGTTTTCCACACGGGCGCCGGCATCAGCACCGCCTCTGGCATCCCCGACT TCAGAGGCCCCCATGGCGTGTGGACCATGGAGGAACGCGGCCTGGCCCCCAAGTTTGACACCACCTTCGA GAATGCTCGGCCCTCGAAGACCCACATGGCCCTGGTTCAGCTAGAACGCATGGGCTTCCTCAGCTTCCTG GTCAGCCAGAACGTAGACGGGCTGCACGTGCGCTCGGGCTTCCCCAGGGACAAGCTGGCAGAGCTGCACG GAAACATGTTTGTAGAGGAATGTCCCAAGTGTAAGACGCAGTACGTCAGAGACACGGTTGTGGGCACCAT GGGCCTCAAGGCCACAGGCCGGCTCTGCACCGTGGCCAAGACCAGGGGACTTCGGGCCTGTAGAGGGGAG CTGAGAGACACCATTCTGGACTGGGAGGACTCGTTGCCTGACCGGGACCTGATGCTCGCTGATGAGGCCA GCAGGACCGCAGACCTGTCTGTCACCCTGGGTACCTCGCTGCAGATCCGCCCCAGTGGGAACCTGCCCCT TGCCACTAAGCGCCGAGGAGGCCGTCTGGTCATTGTCAACCTGCAACCCACAAAACATGACCGCCAGGCT GACCTGCGCATCCACGGCTACGTGGATGAGGTGATGTGCAGACTCATGAAGCATCTGGGGCTGGAGATTC CAGCCTGGGATGGACCCTGCGTGCTAGACAAAGCCCTGCCACCTCTGCCTCGCCCAGTAGCACTCAAGGC TGAGCCCCCCGTGCATCTCAATGGTGCAGTGCATGTTTCGTATAAGTCCAAGCCCAACAGCCCTATACTC CACAGGCCCCCCAAAAGAGTGAAGACCGAGGCTGCCCCCAGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001163430 |
Insert Size | 885 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001163430.1, NP_001156902.1 |
RefSeq Size | 1668 bp |
RefSeq ORF | 885 bp |
Locus ID | 50721 |
Gene Summary | NAD-dependent protein deacetylase. Has deacetylase activity towards histone H3K9Ac and H3K56Ac. Modulates acetylation of histone H3 in telomeric chromatin during the S-phase of the cell cycle. Deacetylates histone H3K9Ac at NF-kappa-B target promoters and may down-regulate the expression of a subset of NF-kappa-B target genes. Deacetylation of nucleosomes interferes with RELA binding to target DNA. May be required for the association of WRN with telomeres during S-phase and for normal telomere maintenance. On DNA damage, promotes DNA end resection via deacetylation of RBBP8. Has very weak deacetylase activity and can bind NAD(+) in the absence of acetylated substrate (By similarity). Acts as a corepressor of the transcription factor Hif1a to control the expression of multiple glycolytic genes to regulate glucose homeostasis. Required for genomic stability. Required for normal IGF1 serum levels and normal glucose homeostasis. Modulates cellular senescence and apoptosis. Regulates the production of TNF protein. Has a role in the regulation of life span in male mice, but not in female mice.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the UTRs and 5' coding region and initiates translation at a downstream start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227518 | Sirt6 (tGFP-tagged) - Mouse sirtuin 6 (silent mating type information regulation 2 homolog) 6 (S. cerevisiae) (Sirt6) transcript variant 2, (10ug) |
CNY 3,230.00 |
|
MR227518 | Sirt6 (Myc-DDK-tagged) - Mouse sirtuin 6 (silent mating type information regulation 2, homolog) 6 (S. cerevisiae) (Sirt6), transcript variant 2 |
CNY 2,950.00 |
|
MR227518L3 | Lenti ORF clone of Sirt6 (Myc-DDK-tagged) - Mouse sirtuin 6 (silent mating type information regulation 2, homolog) 6 (S. cerevisiae) (Sirt6), transcript variant 2 |
CNY 4,850.00 |
|
MR227518L4 | Lenti ORF clone of Sirt6 (mGFP-tagged) - Mouse sirtuin 6 (silent mating type information regulation 2, homolog) 6 (S. cerevisiae) (Sirt6), transcript variant 2 |
CNY 4,850.00 |