Dusp13 (NM_013849) Mouse Untagged Clone
CAT#: MC209789
Dusp13 (untagged) - Mouse dual specificity phosphatase 13 (Dusp13), transcript variant 2, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | DUSP13A; DUSP13B; Gm1203; LMW-D; LMW-DSP6; MDSP; TMD; TMDP; TS-D; TS-DSP6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209789 representing NM_013849
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAGGCTGGGCAGAGACCACTGCAGTCTGCCCTTGGCATTTACCTGCCAAAGTCTCTTTCCCAGACAC CTCGATGTCCTTCTGTGAGAACGCTAGCCCCACTTGGTCTGTGCTCCCTAAGAGAAGAGGGGAGACAGAG AGGGAACAGCAGAGGAGACCAGGAGAAATGTGTTCTGAGGTTACAGCTAAAGAGAATGGACTCGCTACAG AAGCAGGAACTTCGGAGGCCAAAGATTCATGGGGCAGTCCAGGTGTCCCCCTACCAGCCACCCACACTGG CCTCTCTGCAGCGATTGCTGTGGGTCCGTCGGACTGCCACACTGACCCACATCAATGAGGTCTGGCCCAA CCTTTTCTTGGGAGATGCGTATGCTGCCAGAGACAAGGGTCGTCTAATCCAGCTGGGCATTACCCATGTT GTGAATGTGGCTGCGGGCAAGTTCCAGGTGGACACAGGTGCCAAGTTCTACCGTGGAACACCTCTGGAGT ACTATGGCATTGAGGCTGATGACAACCCCTTCTTTGACCTCAGCGTCCACTTTCTGCCTGTTGCTCGTTA CATCAGAGATGCCCTCAATATTCCCCGAAGCCGAGTGCTGGTCCACTGCGCTATGGGGGTGAGTCGCTCT GCCACAATTGTCTTGGCCTTCCTCATGATCTTCGAGAACATGACACTGGTAGATGCCATCCAGACGGTGC AGGCCCACCGAGATATCTGTCCCAACTCAGGCTTCCTCCGACAGCTCCAGGTTCTGGACAACAGGCTGAG GCGGGAAACAGGAAGACTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_013849 |
Insert Size | 792 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_013849.3, NP_038877.2 |
RefSeq Size | 1071 bp |
RefSeq ORF | 792 bp |
Locus ID | 27389 |
UniProt ID | Q9QYJ7 |
Gene Summary | Members of the protein-tyrosine phosphatase superfamily cooperate with protein kinases to regulate cell proliferation and differentiation. This superfamily is separated into two families based on the substrate that is dephosphorylated. One family, the dual specificity phosphatases (DSPs) acts on both phosphotyrosine and phosphoserine/threonine residues. This gene encodes different but related DSP proteins through the use of non-overlapping open reading frames, alternate splicing, and presumed different transcription promoters. Expression of the distinct proteins from this gene has been found to be tissue specific and the proteins may be involved in postnatal development of specific tissues. A protein encoded by the upstream ORF was found in skeletal muscle, whereas the encoded protein from the downstream ORF was found only in testis. In humans, a similar pattern of expression was found. Multiple alternatively spliced transcript variants were described, but the full-length sequence of only some were determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks several 5' exons and includes an alternate 5' exon, compared to variant 1. The resulting protein, isoform 2, (also called TMDP) is encoded from the downstream ORF of this gene and is found only in testis. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG218320 | Dusp13 (tGFP-tagged) - Mouse dual specificity phosphatase 13 (Dusp13) transcript variant 2, (10ug) |
CNY 2850.00 |
|
MR218320 | Dusp13 (Myc-DDK-tagged) - Mouse dual specificity phosphatase 13 (Dusp13), transcript variant 2 |
CNY 2400.00 |
|
MR218320L3 | Lenti ORF clone of Dusp13 (Myc-DDK-tagged) - Mouse dual specificity phosphatase 13 (Dusp13), transcript variant 2 |
CNY 4750.00 |
|
MR218320L4 | Lenti ORF clone of Dusp13 (mGFP-tagged) - Mouse dual specificity phosphatase 13 (Dusp13), transcript variant 2 |
CNY 4750.00 |