Uts2 (NM_011910) Mouse Untagged Clone
CAT#: MC209702
Uts2 (untagged) - Mouse urotensin 2 (Uts2), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | pre; prepro-UII; Ucn; Ucn2; UII |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209702 representing NM_011910
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACAGGGTGCCCTTCTGCTGCCTGCTCTTCATAGGACTTCTGAATCCACTGCTGTCCCTTCCCGTCA CGGACACTGGTGAGAGGACTCTTCAGCTTCCAGTGCTTGAGGAAGACGCTCTTCGGGCTCTGGAGGAGCT GGAGAGGATGGCCCTCCTGCAGACCCTGCGTCAGACCATGGGCACGGAAGCAGGGGAGAGCCCTGGAGAA GCAGGTCCCAGCACTGAGACTCCCACTCCACGGGGAAGCATGAGGAAGGCTTTCGCTGGGCAAAATTCTA ACACTGTACTGAGTCGTCTCTTGGCAAGAACCAGGAAACAACATAAGCAACACGGGGCTGCCCCAGAGTG CTTCTGGAAATACTGCATTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_011910 |
| Insert Size | 372 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_011910.2, NP_036040.1 |
| RefSeq Size | 538 bp |
| RefSeq ORF | 372 bp |
| Locus ID | 24111 |
| UniProt ID | Q9QZQ3 |
| Gene Summary | This gene encodes a member of the urotensin family of peptide hormones. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional hormone before secretion into the plasma. Mice lacking the encoded protein have a significantly decreased low density lipoprotein cholesterol profile and hepatic steatosis that is consistent with decreased hepatocyte de novo cholesterol synthesis and apolipoprotein B secretion. [provided by RefSeq, Sep 2016] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG218932 | Uts2 (tGFP-tagged) - Mouse urotensin 2 (Uts2), (10ug) |
CNY 2850.00 |
|
| MR218932 | Uts2 (Myc-DDK-tagged) - Mouse urotensin 2 (Uts2) |
CNY 1200.00 |
|
| MR218932L3 | Lenti ORF clone of Uts2 (Myc-DDK-tagged) - Mouse urotensin 2 (Uts2) |
CNY 4750.00 |
|
| MR218932L4 | Lenti ORF clone of Uts2 (mGFP-tagged) - Mouse urotensin 2 (Uts2) |
CNY 4750.00 |
