Vip (NM_011702) Mouse Untagged Clone

CAT#: MC209641

Vip (untagged) - Mouse vasoactive intestinal polypeptide (Vip), (10ug)



  "NM_011702" in other vectors (4)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209641 representing NM_011702
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAGCCAGAAGCAAGCCTCAGTTCCTGGCATTCCTGATACTCTTCAGTGTGCTGTTCTCTCAGTCGC
TGGCCTGGCCTCTCTTTGGACCACCTTCTGTAGTGAGTAGGCTGGATGACAGGATGCCGTTTGAAGGAGC
AGGTGACCCTGACCAAGTCTCTTTAAAAGCAGACTCTGACATCTTGCAGAATCCCTTAGCAGAAAATGGC
ACACCCTATTATGATGTGTCAAGAAATGCCAGGCATGCTGATGGAGTTTTCACCAGCGATTACAGCAGAC
TTCTGGGTCAGATTTCTGCCAAAAAATACCTTGAGTCACTCATTGGCAAACGAATCAGCAGCAGCATCTC
GGAAGATCCTGTGCCAATCAAACGACACTCTGATGCCGTCTTCACAGATAACTACACCCGCCTCAGAAAG
CAAATGGCTGTGAAGAAATACCTGAACTCCATCCTGAATGGAAAGAGGAGCAGTGAGGGAGATTCTGCAG
ACTTTCTTGAAGAGCTGGAGAAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011702
Insert Size 516 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC089511, AAH89511
RefSeq Size 1466 bp
RefSeq ORF 516 bp
Locus ID 22353
UniProt ID P32648
Gene Summary This gene encodes a neuropeptide of the glucagon/secretin superfamily with potent bronchodilator, immunomodulator and anti-inflammatory properties. The encoded protein is proteolytically processed to generate two structurally similar neuropeptides - vasoactive intestinal peptide (VIP) and peptide histidine isoleucine (PHI). In the digestive tract, VIP stimulates relaxation of enteric smooth muscle, secretion of water and electrolytes, release of insulin and glucagon, and inhibition of gastric acid secretion. In the cardiovascular system, VIP causes coronary vasodilation and stimulates contractility in the heart. Mice lacking VIP exhibit airway hyperresponsiveness and airway inflammation. Male mice lacking VIP exhibit moderate pulmonary arterial hypertension resulting in increased mortality. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...