Ube2b (NM_009458) Mouse Untagged Clone

CAT#: MC209613

Ube2b (untagged) - Mouse ubiquitin-conjugating enzyme E2B, RAD6 homology (S. cerevisiae) (Ube2b), (10ug)



  "NM_009458" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2610301N02Rik; E2-14k; HR6B; mHR6B; Rad6b
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209613 representing NM_009458
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGACCCCGGCCCGTAGGAGGCTCATGCGGGATTTCAAGCGATTGCAAGAGGACCCACCTGTGGGGG
TCAGTGGCGCCCCATCTGAAAACAACATCATGCAGTGGAATGCAGTTATATTTGGACCAGAAGGGACACC
CTTTGAAGATGGTACTTTTAAACTAGTAATAGAATTTTCTGAAGAATATCCAAATAAACCACCAACCGTT
AGGTTTTTATCCAAAATGTTTCATCCAAATGTGTATGCTGATGGTAGCATATGTTTAGATATCCTGCAGA
ATCGATGGAGTCCCACATATGATGTCTCTTCCATCTTAACTTCCATTCAGTCTCTGCTGGATGAACCGAA
TCCAAACAGTCCAGCCAACAGCCAAGCAGCACAGCTTTATCAGGAAAACAAACGGGAGTATGAGAAGAGA
GTTTCGGCCATTGTTGAGCAAAGCTGGAATGATTCATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009458
Insert Size 459 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_009458.4, NP_033484.3
RefSeq Size 2141 bp
RefSeq ORF 459 bp
Locus ID 22210
UniProt ID P63147
Gene Summary Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In association with the E3 enzyme BRE1 (RNF20 and/or RNF40), it plays a role in transcription regulation by catalyzing the monoubiquitination of histone H2B at 'Lys-120' to form H2BK120ub1. H2BK120ub1 gives a specific tag for epigenetic transcriptional activation, elongation by RNA polymerase II, telomeric silencing, and is also a prerequisite for H3K4me and H3K79me formation. In vitro catalyzes 'Lys-11'-, as well as 'Lys-48'- and 'Lys-63'-linked polyubiquitination. Required for postreplication repair of UV-damaged DNA. Associates to the E3 ligase RAD18 to form the UBE2B-RAD18 ubiquitin ligase complex involved in mono-ubiquitination of DNA-associated PCNA on 'Lys-164'. May be involved in neurite outgrowth.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...