Thy1 (NM_009382) Mouse Untagged Clone
CAT#: MC209528
Thy1 (untagged) - Mouse thymus cell antigen 1, theta (Thy1), (10ug)
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | CD90; T25; Thy-1; Thy-1.2; Thy1.1; Thy1.2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209528 representing NM_009382
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAACCCAGCCATCAGCGTCGCTCTCCTGCTCTCAGTCTTGCAGGTGTCCCGAGGGCAGAAGGTGACCA GCCTGACAGCCTGCCTGGTGAACCAAAACCTTCGCCTGGACTGCCGCCATGAGAATAACACCAAGGATAA CTCCATCCAGCATGAGTTCAGCCTGACCCGAGAGAAGAGGAAGCACGTGCTCTCAGGCACCCTTGGGATA CCCGAGCACACGTACCGCTCCCGCGTCACCCTCTCCAACCAGCCCTATATCAAGGTCCTTACCCTAGCCA ACTTCACCACCAAGGATGAGGGCGACTACTTTTGTGAGCTTCAAGTCTCGGGCGCGAATCCCATGAGCTC CAATAAAAGTATCAGTGTGTATAGAGACAAGCTGGTCAAGTGTGGCGGCATAAGCCTGCTGGTTCAGAAC ACATCCTGGATGCTGCTGCTGCTGCTTTCCCTCTCCCTCCTCCAAGCCCTGGACTTCATTTCTCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_009382 |
Insert Size | 489 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC054436, AAH54436 |
RefSeq Size | 1718 bp |
RefSeq ORF | 489 bp |
Locus ID | 21838 |
UniProt ID | P01831 |
Gene Summary | This gene encodes a glycoprotein that is anchored to the cell surface of thymocytes, neuronal and other cells through a glycosyl-phosphatidylinositol moiety. A soluble form of the encoded protein has also been detected in serum and cerebrospinal fluid. The encoded protein undergoes further processing to generate the mature protein which mediates cell-cell interactions to trigger downstream signaling pathways. [provided by RefSeq, Jul 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226700 | Thy1 (tGFP-tagged) - Mouse thymus cell antigen 1 theta (Thy1), (10ug) |
CNY 3400.00 |
|
MR226700 | Thy1 (Myc-DDK-tagged) - Mouse thymus cell antigen 1, theta (Thy1) |
CNY 1800.00 |
|
MR226700L1 | Lenti ORF clone of Thy1 (Myc-DDK-tagged) - Mouse thymus cell antigen 1, theta (Thy1) |
CNY 5890.00 |
|
MR226700L2 | Lenti ORF clone of Thy1 (mGFP-tagged) - Mouse thymus cell antigen 1, theta (Thy1) |
CNY 4200.00 |
|
MR226700L3 | Lenti ORF clone of Thy1 (Myc-DDK-tagged) - Mouse thymus cell antigen 1, theta (Thy1) |
CNY 4200.00 |
|
MR226700L4 | Lenti ORF clone of Thy1 (mGFP-tagged) - Mouse thymus cell antigen 1, theta (Thy1) |
CNY 4200.00 |