Tcf7 (NM_009331) Mouse Untagged Clone

CAT#: MC209498

Tcf7 (untagged) - Mouse transcription factor 7, T-cell specific (Tcf7), (10ug)



  "NM_009331" in other vectors (6)

CNY 3600.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TCF7 Antibody - C-terminal region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI465550; TCF-1; Tcf1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209498 representing NM_009331
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTACAAAGAGACTGTCTACTCTGCCTTCAATCTGCTCATGCCCTACCCACCGGCCTCGGGAGCAGGGC
AGCATCCGCAGCCTCAACCCCCGCTGCATAACAAGCCCGGCCAGCCTCCACATGGCGTCCCCCAGCTTTC
TCCACTCTACGAACATTTCAGCAGTCCACACCCCACCCCTGCACCAGCGGACATCAGCCAGAAGCAAGGA
GTTCACAGGCCGCTGCAGACCCCCGATCTCTCTGGATTTTATTCTCTGACCTCAGGCAGCATGGGACAGC
TCCCCCATACTGTGAGCTGGCCCAGTCCTCCTCTCTACCCCCTGTCCCCTTCCTGCGGATATAGACAGCA
CTTCCCTGCCCCCACTGCAGCCCCTGGCGCCCCCTATCCCAGGTTCACCCACCCATCCTTGATGCTGGGA
TCTGGTGTACCTGGACACCCAGCAGCCATCCCTCACCCGGCCATTGTGCCCTCCTCAGGGAAGCAGGAGC
TGCAGCCATATGATAGAAACCTGAAAACACAGGCAGAACCCAAGGCAGAGAAGGAGGCTAAGAAGCCAGT
CATCAAGAAACCCCTCAATGCGTTCATGCTTTACATGAAGGAGATGAGAGCCAAGGTCATTGCTGAGTGC
ACACTCAAGGAGAGCGCTGCCATCAACCAGATCCTGGGTCGCAGGTGGCATGCACTATCTCGAGAAGAGC
AGGCCAAGTACTATGAACTGGCCCGCAAGGAAAGGCAGCTGCACATGCAGCTATACCCGGGCTGGTCCGC
GCGGGATAACTACGGAAAGAAGAAGAGGCGGTCAAGGGAAAAACATCAAGAATCCACCACAGGAGGAAAA
AGAAATGCATTCGGTACTTACCCGGAGAAGGCCGCTGCCCCAGCCCCGTTCCTTCCGATGACAGTGCTCT
AG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009331
Insert Size 912 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC138596, AAI38597
RefSeq Size 1704 bp
RefSeq ORF 912 bp
Locus ID 21414
UniProt ID Q00417
Gene Summary This gene encodes a transcription factor which is a member of the T-cell specific transcription factor family. The encoded protein is distinct from the hepatic transcription factor, transcription factor 1, which is also referred to by the symbol Tcf1. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...